Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T66011 Target Info
Target Name Complement factor B (CFB)
Synonyms Properdin factor B; PBF2; Glycinerich beta glycoprotein; Glycine-rich beta glycoprotein; GBG; Complement factor B Bb fragment; C3/C5 convertase; BFD; BF
Target Type Successful Target
Gene Name CFB
Biochemical Class Peptidase
UniProt ID
P00751
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-210-5p miRNA Info
miRNA Mature AC
MIMAT0026475
Sequence agccccugcccaccgcacacug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; qPCR [2]
Representative Target(s) Regulated by This miRNA Complement factor B (CFB) Target Info
CFAB_HUMAN
References  Top
REF 1 Genetic variants in microRNAs and their binding sites within gene 3'UTRs associate with susceptibility to age-related macular degeneration. Hum Mutat. 2017 Jul;38(7):827-838.
REF 2 Splenic RNA and MicroRNA Mimics Promote Complement Factor B Production and Alternative Pathway Activation via Innate Immune Signaling. J Immunol. 2016 Mar 15;196(6):2788-98.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.