Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T77913 Target Info
Target Name Histamine H1 receptor (H1R)
Synonyms HH1R; H1R
Target Type Successful Target
Gene Name HRH1
Biochemical Class GPCR rhodopsin
UniProt ID
P35367
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR from HRH1 was regulated by miR-192 but not by miR-192mut, indicating that these 3'UTR can confer regulation of a heterologous gene by miR-192. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
References  Top
REF 1 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.