Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T78356 |
Target Info
|
Target Name |
Thromboxane-A synthase (TBXAS1) |
Synonyms |
Thromboxane A2 synthase; TXS; TXA synthase; Cytochrome P450 5A1; CYP5A1; CYP5 |
Target Type |
Clinical trial Target |
Gene Name |
TBXAS1 |
Biochemical Class |
Intramolecular oxidoreductase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-34b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaucacuaacuccacugccau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
References |
Top |
REF 1 |
Thromboxane A2 receptor promotes tumor growth through an autoregulatory feedback pathway. J Mol Cell Biol. 2013 Dec;5(6):380-90.
|
REF 2 |
miR-34b-3p May Promote Antiplatelet Efficiency of Aspirin by Inhibiting Thromboxane Synthase Expression. Thromb Haemost. 2019 Sep;119(9):1451-1460.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.