Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T81358 | Target Info | |||
| Target Name | CDC7-related kinase (CDC7) | ||||
| Synonyms | huCdc7; HsCdc7; Cell division cycle 7related protein kinase; Cell division cycle 7-related protein kinase; CDC7related kinase; CDC7L1 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | CDC7 | ||||
| Biochemical Class | Kinase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-192-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cugaccuaugaauugacagcc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | 3'UTR from CDC7 was regulated by miR-192 but not by miR-192mut, indicating that these 3'UTR can confer regulation of a heterologous gene by miR-192. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [1] | |||
| 2 | qRT-PCR | [2] | |||
| Representative Target(s) Regulated by This miRNA | Activated leukocyte cell adhesionmolecule (ALCAM) | Target Info | |||
| Activin receptor type IIB (ACVR2B) | Target Info | ||||
| miRNA Mature ID | hsa-miR-29a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uagcaccaucugaaaucgguua | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Aryl hydrocarbon receptor (AHR) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12. | ||||
| REF 2 | p53 controls CDC7 levels to reinforce G1 cell cycle arrest upon genotoxic stress. Cell Cycle. 2016 Nov;15(21):2958-2972. | ||||
| REF 3 | MicroRNA-29a regulates the benzo[a]pyrene dihydrodiol epoxide-induced DNA damage response through Cdc7 kinase in lung cancer cells. Oncogenesis. 2013 Jul 22;2:e57. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.