Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T81358 Target Info
Target Name CDC7-related kinase (CDC7)
Synonyms huCdc7; HsCdc7; Cell division cycle 7related protein kinase; Cell division cycle 7-related protein kinase; CDC7related kinase; CDC7L1
Target Type Clinical trial Target
Gene Name CDC7
Biochemical Class Kinase
UniProt ID
O00311
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR from CDC7 was regulated by miR-192 but not by miR-192mut, indicating that these 3'UTR can confer regulation of a heterologous gene by miR-192. [1]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
REF 2 p53 controls CDC7 levels to reinforce G1 cell cycle arrest upon genotoxic stress. Cell Cycle. 2016 Nov;15(21):2958-2972.
REF 3 MicroRNA-29a regulates the benzo[a]pyrene dihydrodiol epoxide-induced DNA damage response through Cdc7 kinase in lung cancer cells. Oncogenesis. 2013 Jul 22;2:e57.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.