Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T86734 |
Target Info
|
| Target Name |
Glutaminase (GLS) |
| Synonyms |
L-glutamine amidohydrolase; Glutaminase, mitochondrial; GLS |
| Target Type |
Clinical trial Target |
| Gene Name |
GLS; GLS2 |
| Biochemical Class |
Carbon-nitrogen hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuucc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-23a directly targets GLS1 mRNA in human RPE cells. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
DNA topoisomerase I (TOP1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Inhibition of the oxidative stress-induced miR-23a protects the human retinal pigment epithelium (RPE) cells from apoptosis through the upregulation of glutaminase and glutamine uptake. Mol Biol Rep. 2016 Oct;43(10):1079-87.
|
| REF 2 |
CFIm25 regulates glutaminase alternative terminal exon definition to modulate miR-23 function. RNA. 2016 Jun;22(6):830-8.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
