Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T91180 Target Info
Target Name Solute carrier family 15 member 1 (SLC15A1)
Synonyms PEPT1; Oligopeptide transporter, small intestine isoform; Intestinal H(+)/peptide cotransporter
Target Type Literature-reported Target
Gene Name SLC15A1
Biochemical Class Proton-dependent oligopeptide transporter
UniProt ID
P46059
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism miR-92b downregulates hPepT1 expression, causing reduced hPepT1 transport activity in intestinal epithelial cells by targeting the 3'UTR of hPepT1 Mrna. [1]
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
References  Top
REF 1 MicroRNA-92b regulates expression of the oligopeptide transporter PepT1 in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol. 2011 Jan;300(1):G52-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.