Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T92865 |
Target Info
|
| Target Name |
Kinesin-like protein KIF20B (MPHOSPH1) |
| Synonyms |
Mphase phosphoprotein 1; MPP1; M-phase phosphoprotein 1; Kinesinrelated motor interacting with PIN1; Kinesinlike protein KIF20B; Kinesin-related motor interacting with PIN1; Kinesin family member 20B; KRMP1; Cancer/testis antigen 90; CT90 |
| Target Type |
Literature-reported Target |
| Gene Name |
KIF20B |
| Biochemical Class |
Myosin-kinesin ATPase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-192-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cugaccuaugaauugacagcc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
3'UTR from KIF20B was regulated by miR-192 but not by miR-192mut, indicating that these 3'UTR can confer regulation of a heterologous gene by miR-192. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
|
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
