Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T94449 |
Target Info
|
| Target Name |
Protein-tyrosine phosphatase eta (HPTP) |
| Synonyms |
Receptor-type tyrosine-protein phosphatase eta; R-PTP-eta; R-PTP-J; Protein-tyrosine phosphatase receptor type J; HPTP eta; Density-enhanced phosphatase 1; DEP1; DEP-1; CD148 |
| Target Type |
Patented-recorded Target |
| Gene Name |
PTPRJ |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-328-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cuggcccucucugcccuuccgu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-328 interacts directly with the 3'UTR of PTPRJ mRNA to suppress PTPRJ expression. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qRT-PCR; Western Blot |
[1] |
| 2 |
Western Blot; RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
|
Beta-secretase 1 (BACE1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Protein tyrosine phosphatase PTPRJ is negatively regulated by microRNA-328. FEBS J. 2013 Jan;280(2):401-12.
|
| REF 2 |
MicroRNA-328 enhances cellular motility through posttranscriptional regulation of PTPRJ in human hepatocellular carcinoma. Onco Targets Ther. 2015 Oct 28;8:3159-67.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
