Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T94449 Target Info
Target Name Protein-tyrosine phosphatase eta (HPTP)
Synonyms Receptor-type tyrosine-protein phosphatase eta; R-PTP-eta; R-PTP-J; Protein-tyrosine phosphatase receptor type J; HPTP eta; Density-enhanced phosphatase 1; DEP1; DEP-1; CD148
Target Type Patented-recorded Target
Gene Name PTPRJ
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
Q12913
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-328-3p miRNA Info
miRNA Mature AC
MIMAT0000752
Sequence cuggcccucucugcccuuccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-328 interacts directly with the 3'UTR of PTPRJ mRNA to suppress PTPRJ expression. [1]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
References  Top
REF 1 Protein tyrosine phosphatase PTPRJ is negatively regulated by microRNA-328. FEBS J. 2013 Jan;280(2):401-12.
REF 2 MicroRNA-328 enhances cellular motility through posttranscriptional regulation of PTPRJ in human hepatocellular carcinoma. Onco Targets Ther. 2015 Oct 28;8:3159-67.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.