Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T95371 Target Info
Target Name Interferon alpha/beta receptor 1 (IFNAR1)
Synonyms Type I interferon receptor 1; IFNalpha/beta receptor 1; IFNR1; IFNAR; IFN-alpha/beta receptor 1; IFN-R-1; Cytokine receptor family 2 member 1; Cytokine receptor classII member 1; Cytokine receptor class-II member 1; CRF21; CRF2-1
Target Type Clinical trial Target
Gene Name IFNAR1
Biochemical Class Cytokine receptor
UniProt ID
P17181
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a could directly target IFNAR1 30-UTR and downregulate IFNAR1 expression. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 Respiratory syncytial virus non-structural protein 1 facilitates virus replication through miR-29a-mediated inhibition of interferon- receptor. Biochem Biophys Res Commun. 2016 Sep 23;478(3):1436-41.
REF 2 MicroRNA expression changes during interferon-beta treatment in the peripheral blood of multiple sclerosis patients. Int J Mol Sci. 2013 Aug 5;14(8):16087-110.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.