Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T95842 |
Target Info
|
| Target Name |
Monocarboxylate transporter 1 (SLC16A1) |
| Synonyms |
Solute carrier family 16 member 1; MCT1; MCT 1 |
| Target Type |
Literature-reported Target |
| Gene Name |
SLC16A1 |
| Biochemical Class |
Major facilitator |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-124-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaaggcacgcggugaaugcc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-124-3p by mature miRNA precursor transfection resulted in the changed mRNA level of target SLC16A1. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Microarray; qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-376a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guagauucuccuucuaugagua
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Dual specificity protein kinase TTK (MPS1)
|
Target Info
|
|
|
Monocarboxylate transporter 1 (SLC16A1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1. Hum Pathol. 2009 Sep;40(9):1234-43.
|
| REF 2 |
Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res. 2006 Mar 20;34(5):1646-52. Print 2006.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
