miRNA General Information
miRNA Mature ID	hsa-miR-10a-3p
miRNA Stemloop AC	MI0000266
miRNA Stemloop ID	hsa-mir-10a
Sequence	caaauucguaucuaggggaaua
TTD Target(s) Regulated by This miRNA	Renal carcinoma antigen NY-REN-64 (IRAK-4)	Clinical trial Target	Target Info	[1]
Protein(s) Regulated by This miRNA	F-box/WD repeat-containing protein 1A	Regulated Protein	FBW1A_HUMAN	[2]
	Nuclear receptor subfamily 2 group C member 2	Regulated Protein	NR2C2_HUMAN	[2]
References
REF 1	Regulation of TLR2-mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. J Immunol. 2013 Feb 1;190(3):1250-63.
REF 2	A novel NF-B/YY1/microRNA-10a regulatory circuit in fibroblast-like synoviocytes regulates inflammation in rheumatoid arthritis. Sci Rep. 2016 Jan 29;6:20059.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.