miRNA General Information
miRNA Mature ID	hsa-miR-10b-3p
miRNA Stemloop AC	MI0000267
miRNA Stemloop ID	hsa-mir-10b
Sequence	acagauucgauucuaggggaau
TTD Target(s) Regulated by This miRNA	Polo-like kinase 1 (PLK1)	Clinical trial Target	Target Info	[1]
	BUB1 mitotic checkpoint serine/threonine kinase (BUB1)	Patented-recorded Target	Target Info	[1]
	Cyclin A2 (CCNA2)	Literature-reported Target	Target Info	[1]
References
REF 1	miR-10b*, a master inhibitor of the cell cycle, is down-regulated in human breast tumours. EMBO Mol Med. 2012 Nov;4(11):1214-29.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.