miRNA General Information
miRNA Mature ID	hsa-miR-1224-3p
miRNA Stemloop AC	MI0003764
miRNA Stemloop ID	hsa-mir-1224
Sequence	ccccaccuccucucuccucag
TTD Target(s) Regulated by This miRNA	Apoptosis signal-regulating kinase 1 (MAP3K5)	Clinical trial Target	Target Info	[1]
	ADAM metallopeptidase with thrombospondin 1 (ADAMTS1)	Literature-reported Target	Target Info	[1]
	Cyclic AMP-responsive element-binding protein (CREB1)	Literature-reported Target	Target Info	[1]
References
REF 1	Reorganization of metastamiRs in the evolution of metastatic aggressive neuroblastoma cells. BMC Genomics. 2015 Jul 7;16:501.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.