miRNA General Information
miRNA Mature ID	hsa-miR-1226-3p
miRNA Stemloop AC	MI0006313
miRNA Stemloop ID	hsa-mir-1226
Sequence	ucaccagcccuguguucccuag
TTD Target(s) Regulated by This miRNA	Mucin-1 (MUC1)	Clinical trial Target	Target Info	[1]
References
REF 1	miR-1226 targets expression of the mucin 1 oncoprotein and induces cell death. Int J Oncol. 2010 Jul;37(1):61-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.