miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1236-3p | ||||
| miRNA Stemloop AC | MI0006326 | ||||
| miRNA Stemloop ID | hsa-mir-1236 | ||||
| Sequence | ccucuuccccuugucucuccag | ||||
| TTD Target(s) Regulated by This miRNA | Vascular endothelial growth factor receptor 2 (KDR) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor receptor 3 (FLT-4) | Successful Target | Target Info | [1] | ||
| Nuclear receptor ROR-gamma (RORG) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Transcription elongation factor A protein-like 1 | Regulated Protein | [3] | ||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Mirtron microRNA-1236 inhibits VEGFR-3 signaling during inflammatory lymphangiogenesis. Arterioscler Thromb Vasc Biol. 2012 Mar;32(3):633-42. | ||||
| REF 2 | Adipose-Derived Mesenchymal Stem Cells Ameliorate Ulcerative Colitis Through miR-1236 Negatively Regulating the Expression of Retinoid-Related Orphan Receptor Gamma. DNA Cell Biol. 2015 Oct;34(10):618-25. | ||||
| REF 3 | Up-regulation of p21(WAF1/CIP1) by miRNAs and its implications in bladder cancer cells.FEBS Lett. 2014 Dec 20;588(24):4654-64. | ||||
| REF 4 | miR-1236-3p represses the cell migration and invasion abilities by targeting ZEB1 in high-grade serous ovarian carcinoma.Oncol Rep. 2014 Apr;31(4):1905-10. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.