miRNA General Information
miRNA Mature ID	hsa-miR-125b-2-3p
miRNA Stemloop AC	MI0000470
miRNA Stemloop ID	hsa-mir-125b-2
Sequence	ucacaagucaggcucuugggac
TTD Target(s) Regulated by This miRNA	Insulin-like growth factor I receptor (IGF1R)	Successful Target	Target Info	[1]
References
REF 1	Regulation of several androgen-induced genes through the repression of the miR-99a/let-7c/miR-125b-2 miRNA cluster in prostate cancer cells. Oncogene. 2014 Mar 13;33(11):1448-57.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.