miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-135b-5p | ||||
| miRNA Stemloop AC | MI0000810 | ||||
| miRNA Stemloop ID | hsa-mir-135b | ||||
| Sequence | uauggcuuuucauuccuauguga | ||||
| TTD Target(s) Regulated by This miRNA | Extracellular calcium-sensing receptor (CASR) | Successful Target | Target Info | [1] | |
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [2] | ||
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [3] | ||
| Bone morphogenetic protein receptor (BMPR2) | Literature-reported Target | Target Info | [2] | ||
| Activin receptor type IB (ACVR1B) | Patented-recorded Target | Target Info | [2] | ||
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [4] | ||
| Signal transducer and activator of transcription 6 (STAT6) | Literature-reported Target | Target Info | [5] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [6] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Adenomatous polyposis coli protein | Regulated Protein | [8] | ||
| Bone sialoprotein 2 | Regulated Protein | [6] | |||
| Disintegrin and metalloproteinase domain-containing protein 12 | Regulated Protein | [10] | |||
| E3 ubiquitin-protein ligase Midline-1 | Regulated Protein | [11] | |||
| Ecotropic viral integration site 5 protein homolog | Regulated Protein | [7] | |||
| Leucine zipper putative tumor suppressor 1 | Regulated Protein | [13] | |||
| Mitochondrial carrier homolog 2 | Regulated Protein | [11] | |||
| Mothers against decapentaplegic homolog 5 | Regulated Protein | [14] | |||
| Myocyte-specific enhancer factor 2C | Regulated Protein | [15] | |||
| Osteocalcin | Regulated Protein | [6] | |||
| Protein phosphatase 1E | Regulated Protein | [16] | |||
| Protein phosphatase 1E | Regulated Protein | [17] | |||
| Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform | Regulated Protein | [18] | |||
| Thrombospondin-2 | Regulated Protein | [19] | |||
| Transcription factor MafB | Regulated Protein | [3] | |||
| Transcription factor Sp7 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | MicroRNA-135b acts as a tumor promoter by targeting the hypoxia-inducible factor pathway in genetically defined mouse model of head and neck squamous cell carcinoma. Cancer Lett. 2013 May 1;331(2):230-8. | ||||
| REF 2 | MiR-135b is a direct PAX6 target and specifies human neuroectoderm by inhibiting TGF-/BMP signaling. EMBO J. 2014 Jun 2;33(11):1271-83. | ||||
| REF 3 | Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11. | ||||
| REF 4 | Down-regulation of microRNA-135b inhibited growth of cervical cancer cells by targeting FOXO1. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10294-304. | ||||
| REF 5 | miR-135b inhibits tumour metastasis in prostate cancer by targeting STAT6. Oncol Lett. 2016 Jan;11(1):543-550. | ||||
| REF 6 | MicroRNA hsa-miR-135b regulates mineralization in osteogenic differentiation of human unrestricted somatic stem cells. Stem Cells Dev. 2010 Jun;19(6):877-85. | ||||
| REF 7 | MicroRNA-135b, a HSF1 target, promotes tumor invasion and metastasis by regulating RECK and EVI5 in hepatocellular carcinoma. Oncotarget. 2015 Feb 10;6(4):2421-33. | ||||
| REF 8 | Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer.Cancer Res. 2008 Jul 15;68(14):5795-802. | ||||
| REF 9 | MicroRNA hsa-miR-135b regulates mineralization in osteogenic differentiation of human unrestricted somatic stem cells. Stem Cells Dev. 2010 Jun;19(6):877-85. | ||||
| REF 10 | miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal.Oncotarget. 2015 Nov 10;6(35):37241-56. | ||||
| REF 11 | miR-135b coordinates progression of ErbB2-driven mammary carcinomas through suppression of MID1 and MTCH2.Am J Pathol. 2013 Jun;182(6):2058-70. | ||||
| REF 12 | MicroRNA-135b, a HSF1 target, promotes tumor invasion and metastasis by regulating RECK and EVI5 in hepatocellular carcinoma. Oncotarget. 2015 Feb 10;6(4):2421-33. | ||||
| REF 13 | MicroRNA-135b promotes lung cancer metastasis by regulating multiple targets in the Hippo pathway and LZTS1.Nat Commun. 2013;4:1877. | ||||
| REF 14 | Upregulation of miR-135b is involved in the impaired osteogenic differentiation of mesenchymal stem cells derived from multiple myeloma patients.PLoS One. 2013 Nov 6;8(11):e79752. | ||||
| REF 15 | MiR-135b-5p and MiR-499a-3p Promote Cell Proliferation and Migration in Atherosclerosis by Directly Targeting MEF2C.Sci Rep. 2015 Jul 17;5:12276. | ||||
| REF 16 | miR-135b expression downregulates Ppm1e to activate AMPK signaling and protect osteoblastic cells from dexamethasone.Oncotarget. 2016 Oct 25;7(43):70613-70622. | ||||
| REF 17 | AMPK phosphatase Ppm1E upregulation in human gastric cancer is required for cell proliferation.Oncotarget. 2017 May 9;8(19):31288-31296. | ||||
| REF 18 | Computational dissection of distinct microRNA activity signatures associated with peripheral T cell lymphoma subtypes.Leukemia. 2013 Oct;27(10):2107-11. | ||||
| REF 19 | miR-135b, a key regulator of malignancy, is linked to poor prognosis in human myxoid liposarcoma.Oncogene. 2016 Dec 1;35(48):6177-6188. | ||||
| REF 20 | Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.