miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-137-3p | ||||
| miRNA Stemloop AC | MI0000454 | ||||
| miRNA Stemloop ID | hsa-mir-137 | ||||
| Sequence | uuauugcuuaagaauacgcguag | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
| REF 2 | MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.