miRNA General Information
miRNA Mature ID	hsa-miR-138-5p
miRNA Stemloop AC	MI0000455 | MI0000476
miRNA Stemloop ID	hsa-mir-138-2 | hsa-mir-138-1
Sequence	agcugguguugugaaucaggccg
TTD Target(s) Regulated by This miRNA	Rho-associated protein kinase 2 (ROCK2)	Successful Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Adhesion G protein-coupled receptor A2	Regulated Protein	AGRA2_HUMAN	[2]
	B-cell lymphoma/leukemia 11A	Regulated Protein	BC11A_HUMAN	[3]
	BAG family molecular chaperone regulator 1	Regulated Protein	BAG1_HUMAN	[4]
	Bladder cancer-associated protein	Regulated Protein	BLCAP_HUMAN	[5]
	CCAAT/enhancer-binding protein alpha	Regulated Protein	CEBPA_HUMAN	[6]
	E3 ubiquitin-protein transferase RMND5A	Regulated Protein	RMD5A_HUMAN	[7]
	EP300-interacting inhibitor of differentiation 1	Regulated Protein	EID1_HUMAN	[6]
	Fermitin family homolog 2	Regulated Protein	FERM2_HUMAN	[8]
	Guanine nucleotide-binding protein G(i) subunit alpha-2	Regulated Protein	GNAI2_HUMAN	[9]
	Max dimerization protein 1	Regulated Protein	MAD1_HUMAN	[5]
	Pleckstrin-2	Regulated Protein	PLEK2_HUMAN	[10]
	Polycomb protein EED	Regulated Protein	EED_HUMAN	[10]
	Polycomb protein SUZ12	Regulated Protein	SUZ12_HUMAN	[10]
	Protein S100-A1	Regulated Protein	S10A1_HUMAN	[11]
	Reelin	Regulated Protein	RELN_HUMAN	[12]
	Rho guanine nucleotide exchange factor 3	Regulated Protein	ARHG3_HUMAN	[1]
	Rho-related GTP-binding protein RhoC	Regulated Protein	RHOC_HUMAN	[14]
	Solute carrier family 45 member 3	Regulated Protein	S45A3_HUMAN	[15]
	Transcription factor SOX-4	Regulated Protein	SOX4_HUMAN	[16]
	Transcription factor SOX-9	Regulated Protein	SOX9_HUMAN	[17]
	Twist-related protein 2	Regulated Protein	TWST2_HUMAN	[18]
	Vimentin	Regulated Protein	VIME_HUMAN	[10]
	Zinc finger protein SNAI2	Regulated Protein	SNAI2_HUMAN	[10]
References
REF 1	Downregulation of the Rho GTPase signaling pathway is involved in the microRNA-138-mediated inhibition of cell migration and invasion in tongue squamous cell carcinoma. Int J Cancer. 2010 Aug 1;127(3):505-12.
REF 2	miR-138-5p reverses gefitinib resistance in non-small cell lung cancer cells via negatively regulating G protein-coupled receptor 124.Biochem Biophys Res Commun. 2014 Mar 28;446(1):179-86.
REF 3	Reciprocal regulation of -globin expression by exo-miRNAs: Relevance to -globin silencing in -thalassemia major. Sci Rep. 2017 Mar 16;7(1):202.
REF 4	MiR-138 Suppresses Cell Proliferation by Targeting Bag-1 in Gallbladder Carcinoma.PLoS One. 2015 May 11;10(5):e0126499.
REF 5	Targeting glioma stem cells by functional inhibition of a prosurvival oncomiR-138 in malignant gliomas.Cell Rep. 2012 Sep 27;2(3):591-602.
REF 6	MicroRNA hsa-miR-138 inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells through adenovirus EID-1.Stem Cells Dev. 2011 Feb;20(2):259-67.
REF 7	MiR-138 downregulates miRNA processing in HeLa cells by targeting RMND5A and decreasing Exportin-5 stability.Nucleic Acids Res. 2014 Jan;42(1):458-74.
REF 8	miR-138-Mediated Regulation of KINDLIN-2 Expression Modulates Sensitivity to Chemotherapeutics.Mol Cancer Res. 2016 Feb;14(2):228-38.
REF 9	Identification and experimental validation of G protein alpha inhibiting activity polypeptide 2 (GNAI2) as a microRNA-138 target in tongue squamous cell carcinoma.Hum Genet. 2011 Feb;129(2):189-97.
REF 10	MicroRNA-138 suppresses epithelial-mesenchymal transition in squamous cell carcinoma cell lines.Biochem J. 2011 Nov 15;440(1):23-31.
REF 11	MicroRNA-138 regulates hypoxia-induced endothelial cell dysfunction by targeting S100A1.PLoS One. 2013 Nov 11;8(11):e78684.
REF 12	MiR-138 promotes the migration of cultured chicken embryonic hypothalamic cells by targeting reelin.Neuroscience. 2013 May 15;238:114-24.
REF 13	Downregulation of the Rho GTPase signaling pathway is involved in the microRNA-138-mediated inhibition of cell migration and invasion in tongue squamous cell carcinoma. Int J Cancer. 2010 Aug 1;127(3):505-12.
REF 14	Evaluating the microRNA targeting sites by luciferase reporter gene assay.Methods Mol Biol. 2013;936:117-27.
REF 15	Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells.J Mol Med (Berl). 2008 Mar;86(3):313-22.
REF 16	MicroRNA-138 suppresses ovarian cancer cell invasion and metastasis by targeting SOX4 and HIF-1.Int J Cancer. 2013 Aug 15;133(4):867-78.
REF 17	miR-138 suppresses cell proliferation and invasion by inhibiting SOX9 in hepatocellular carcinoma. Am J Transl Res. 2016 May 15;8(5):2159-68.
REF 18	Down-regulation of miR-138 promotes colorectal cancer metastasis via directly targeting TWIST2.J Transl Med. 2013 Oct 30;11:275.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.