miRNA General Information
miRNA Mature ID hsa-miR-144-3p
miRNA Stemloop AC MI0000460
miRNA Stemloop ID hsa-mir-144
Sequence uacaguauagaugauguacu
TTD Target(s) Regulated by This miRNA Serine/threonine-protein kinase mTOR (mTOR) Successful Target Target Info [1]
Proto-oncogene c-Met (MET) Successful Target Target Info [2]
Amyloid beta A4 protein (APP) Successful Target Target Info [3]
cAMP-dependent chloride channel (CFTR) Successful Target Target Info [4]
Prostaglandin G/H synthase 2 (COX-2) Successful Target Target Info [5]
Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [6]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [7]
Nuclear factor erythroid 2-related factor 2 (Nrf2) Clinical trial Target Target Info [8]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [9]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [10]
ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Literature-reported Target Target Info [11]
Fibrinogen (FGG) Literature-reported Target Target Info [12]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [13]
Insulin receptor substrate-1 (IRS1) Clinical trial Target Target Info [14]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [15]
Protein(s) Regulated by This miRNA Fibrinogen alpha chain Regulated Protein [12]
Fibrinogen beta chain Regulated Protein [12]
Mothers against decapentaplegic homolog 4 Regulated Protein [17]
Pre-B-cell leukemia transcription factor 3 Regulated Protein [18]
Titin Regulated Protein [19]
Zinc finger E-box-binding homeobox 1 Regulated Protein [15]
Zinc finger protein PLAG1 Regulated Protein [21]
Zinc finger X-chromosomal protein Regulated Protein [22]
References
REF 1 Downregulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 2012 Dec;33(12):2391-7.
REF 2 MicroRNA-144 inhibits the metastasis of gastric cancer by targeting MET expression. J Exp Clin Cancer Res. 2015 Apr 17;34:35.
REF 3 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 4 MiR-101 and miR-144 regulate the expression of the CFTR chloride channel in the lung. PLoS One. 2012;7(11):e50837.
REF 5 MiR-26a and miR-144 inhibit proliferation and metastasis of esophageal squamous cell cancer by inhibiting cyclooxygenase-2. Oncotarget. 2016 Mar 22;7(12):15173-86.
REF 6 Post-transcriptional regulation of Transforming Growth Factor Beta-1 by microRNA-744. PLoS One. 2011;6(10):e25044.
REF 7 miR-144 downregulation increases bladder cancer cell proliferation by targeting EZH2 and regulating Wnt signaling. FEBS J. 2013 Sep;280(18):4531-8.
REF 8 Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells. PLoS One. 2012;7(12):e51111.
REF 9 DCAMKL-1 regulates epithelial-mesenchymal transition in human pancreatic cells through a miR-200a-dependent mechanism. Cancer Res. 2011 Mar 15;71(6):2328-38.
REF 10 MicroRNA-144 promotes cell proliferation, migration and invasion in nasopharyngeal carcinoma through repression of PTEN. Carcinogenesis. 2013 Feb;34(2):454-63.
REF 11 Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. Oncogene. 2015 Jun;34(25):3283-95.
REF 12 Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 13 miR-144-3p, a tumor suppressive microRNA targeting ETS-1 in laryngeal squamous cell carcinoma. Oncotarget. 2016 Mar 8;7(10):11637-50.
REF 14 miR-144 suppresses the growth and metastasis of laryngeal squamous cell carcinoma by targeting IRS1. Am J Transl Res. 2016 Jan 15;8(1):1-11.
REF 15 miR-144 functions as a tumor suppressor in breast cancer through inhibiting ZEB1/2-mediated epithelial mesenchymal transition process. Onco Targets Ther. 2016 Oct 11;9:6247-6255.
REF 16 Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15.
REF 17 MiR-144-3p regulates osteogenic differentiation and proliferation of murine mesenchymal stem cells by specifically targeting Smad4.FEBS Lett. 2016 Mar;590(6):795-807.
REF 18 MicroRNA-144-3p suppresses gastric cancer progression by inhibiting epithelial-to-mesenchymal transition through targeting PBX3.Biochem Biophys Res Commun. 2017 Mar 4;484(2):241-247.
REF 19 Requirement of miR-144 in CsA induced proliferation and invasion of human trophoblast cells by targeting titin.J Cell Biochem. 2014 Apr;115(4):690-6.
REF 20 miR-144 functions as a tumor suppressor in breast cancer through inhibiting ZEB1/2-mediated epithelial mesenchymal transition process. Onco Targets Ther. 2016 Oct 11;9:6247-6255.
REF 21 Alterations in miRNA processing and expression in pleomorphic adenomas of the salivary gland.Int J Cancer. 2009 Jun 15;124(12):2855-63.
REF 22 Clinical significance of miR-144-ZFX axis in disseminated tumour cells in bone marrow in gastric cancer cases.Br J Cancer. 2012 Oct 9;107(8):1345-53.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.