miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-150-5p
miRNA Stemloop AC MI0000479
miRNA Stemloop ID hsa-mir-150
Sequence ucucccaacccuuguaccagug
TTD Target(s) Regulated by This miRNA Fms-like tyrosine kinase 3 (FLT-3) Successful Target Target Info [1]
C-X-C chemokine receptor type 4 (CXCR4) Successful Target Target Info [2]
Protein kinase C alpha (PRKCA) Successful Target Target Info [3]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [4]
Matrix metalloproteinase-14 (MMP-14) Clinical trial Target Target Info [5]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [6]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [7]
P2X purinoceptor 7 (P2RX7) Clinical trial Target Target Info [8]
Epiregulin (EREG) Clinical trial Target Target Info [9]
Notch-3 receptor (NOTCH3) Clinical trial Target Target Info [10]
Insulin-like growth factor-II (IGF2) Clinical trial Target Target Info [11]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [12]
Signal transducer and activator of transcription 1 (STAT1) Patented-recorded Target Target Info [13]
Histone acetyltransferase p300 (EP300) Clinical trial Target Target Info [14]
Signal transduction protein CBL (CBL) Literature-reported Target Target Info [15]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [16]
HepG2 glucose transporter (SLC2A1) Preclinical Target Target Info [17]
Beta-arrestin-2 (ARRB2) Literature-reported Target Target Info [18]
Protein(s) Regulated by This miRNA Adiponectin receptor protein 2 Regulated Protein
PAQR2_HUMAN
[9]
Apoptosis-inducing factor 2 Regulated Protein
AIFM2_HUMAN
[9]
C-C chemokine receptor type 6 Regulated Protein
CCR6_HUMAN
[20]
Calpastatin Regulated Protein
ICAL_HUMAN
[9]
Collagen alpha-4(IV) chain Regulated Protein
CO4A4_HUMAN
[12]
Consortin Regulated Protein
CNST_HUMAN
[9]
Cytokine-inducible SH2-containing protein Regulated Protein
CISH_HUMAN
[22]
DNA polymerase delta subunit 3 Regulated Protein
DPOD3_HUMAN
[23]
E3 SUMO-protein ligase EGR2 Regulated Protein
EGR2_HUMAN
[24]
Homeobox protein NANOG Regulated Protein
NANOG_HUMAN
[25]
LisH domain-containing protein FOPNL Regulated Protein
FOPNL_HUMAN
[9]
Mucin-4 Regulated Protein
MUC4_HUMAN
[26]
Protein disulfide-isomerase A6 Regulated Protein
PDIA6_HUMAN
[9]
Signal transducer and activator of transcription 5B Regulated Protein
STA5B_HUMAN
[27]
Sjoegren syndrome/scleroderma autoantigen 1 Regulated Protein
SSA27_HUMAN
[28]
SRC kinase signaling inhibitor 1 Regulated Protein
SRCN1_HUMAN
[29]
Synaptopodin-2 Regulated Protein
SYNP2_HUMAN
[9]
Target of Myb protein 1 Regulated Protein
TOM1_HUMAN
[9]
Zinc finger E-box-binding homeobox 1 Regulated Protein
ZEB1_HUMAN
[30]
Zinc finger E-box-binding homeobox 1 Regulated Protein
ZEB1_HUMAN
[31]
Zinc finger protein 350 Regulated Protein
ZN350_HUMAN
[32]
Zinc finger transcription factor Trps1 Regulated Protein
TRPS1_HUMAN
[9]
References
REF 1 Blockade of miR-150 maturation by MLL-fusion/MYC/LIN-28 is required for MLL-associated leukemia. Cancer Cell. 2012 Oct 16;22(4):524-35.
REF 2 microRNA-150 regulates mobilization and migration of bone marrow-derived mononuclear cells by targeting Cxcr4. PLoS One. 2011;6(10):e23114.
REF 3 Specific miRNA and its target in neutrophils after traumatic injury. Acta Biochim Biophys Sin (Shanghai). 2015 Sep;47(9):749-54.
REF 4 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 5 miR-150-5p inhibits hepatoma cell migration and invasion by targeting MMP14. PLoS One. 2014 Dec 30;9(12):e115577.
REF 6 Low expression of miR-150 in pediatric intestinal Burkitt lymphoma. Exp Mol Pathol. 2014 Apr;96(2):261-6.
REF 7 miR-150, p53 protein and relevant miRNAs consist of a regulatory network in NSCLC tumorigenesis. Oncol Rep. 2013 Jul;30(1):492-8.
REF 8 MicroRNAs miR-186 and miR-150 down-regulate expression of the pro-apoptotic purinergic P2X7 receptor by activation of instability sites at the 3'-untranslated region of the gene that decrease steady-state levels of the transcript. J Biol Chem. 2008 Oct 17;283(42):28274-86.
REF 9 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 10 Modulation of microRNA expression in human T-cell development: targeting of NOTCH3 by miR-150. Blood. 2011 Jun 30;117(26):7053-62.
REF 11 IGF-II is regulated by microRNA-125b in skeletal myogenesis. J Cell Biol. 2011 Jan 10;192(1):69-81.
REF 12 Activation of hepatic stellate cells is suppressed by microRNA-150. Int J Mol Med. 2013 Jul;32(1):17-24.
REF 13 STAT1: A Novel Target of miR-150 and miR-223 Is Involved in the Proliferation of HTLV-I-Transformed and ATL Cells. Neoplasia. 2015 May;17(5):449-62.
REF 14 miR-150 regulates high glucose-induced cardiomyocyte hypertrophy by targeting the transcriptional co-activator p300. Exp Cell Res. 2013 Feb 1;319(3):173-84.
REF 15 miR-150 blocks MLL-AF9-associated leukemia through oncogene repression. Mol Cancer Res. 2013 Aug;11(8):912-22.
REF 16 Wnt/-catenin pathway transactivates microRNA-150 that promotes EMT of colorectal cancer cells by suppressing CREB signaling. Oncotarget. 2016 Jul 5;7(27):42513-42526.
REF 17 CD46 Activation Regulates miR-150-Mediated Control of GLUT1 Expression and Cytokine Secretion in Human CD4+ T Cells. J Immunol. 2016 Feb 15;196(4):1636-45.
REF 18 MiR-150 impairs inflammatory cytokine production by targeting ARRB-2 after blocking CD28/B7 costimulatory pathway. Immunol Lett. 2016 Apr;172:1-10.
REF 19 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 20 MicroRNA-150 inhibits tumor invasion and metastasis by targeting the chemokine receptor CCR6, in advanced cutaneous T-cell lymphoma.Blood. 2014 Mar 6;123(10):1499-511.
REF 21 Activation of hepatic stellate cells is suppressed by microRNA-150. Int J Mol Med. 2013 Jul;32(1):17-24.
REF 22 miR-150 promotes renal fibrosis in lupus nephritis by downregulating SOCS1.J Am Soc Nephrol. 2013 Jun;24(7):1073-87.
REF 23 Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway. Mol Carcinog. 2017 Apr;56(4):1372-1379.
REF 24 MiR-150 promotes gastric cancer proliferation by negatively regulating the pro-apoptotic gene EGR2.Biochem Biophys Res Commun. 2010 Feb 12;392(3):340-5.
REF 25 miR-150 Suppresses the Proliferation and Tumorigenicity of Leukemia Stem Cells by Targeting the Nanog Signaling Pathway. Front Pharmacol. 2016 Nov 18;7:439.
REF 26 MicroRNA-150 directly targets MUC4 and suppresses growth and malignant behavior of pancreatic cancer cells.Carcinogenesis. 2011 Dec;32(12):1832-9.
REF 27 MicroRNA fingerprints in juvenile myelomonocytic leukemia (JMML) identified miR-150-5p as a tumor suppressor and potential target for treatment.Oncotarget. 2016 Aug 23;7(34):55395-55408.
REF 28 The regulatory loop of COMP1 and HNF-4-miR-150-p27 in various signaling pathways. Oncol Lett. 2015 Jan;9(1):195-200.
REF 29 miR-150 promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1.Eur J Cancer. 2014 Mar;50(5):1013-24.
REF 30 MiR-150 is associated with poor prognosis in esophageal squamous cell carcinoma via targeting the EMT inducer ZEB1.Cancer Sci. 2013 Jan;104(1):48-54.
REF 31 MicroRNA-200C and -150 play an important role in endothelial cell differentiation and vasculogenesis by targeting transcription repressor ZEB1.Stem Cells. 2013 Sep;31(9):1749-62.
REF 32 Functional SNP in 3'-UTR MicroRNA-Binding Site of ZNF350 Confers Risk for Age-Related Cataract.Hum Mutat. 2016 Nov;37(11):1223-1230.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.