miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-15b-3p | ||||
| miRNA Stemloop AC | MI0000438 | ||||
| miRNA Stemloop ID | hsa-mir-15b | ||||
| Sequence | cgaaucauuauuugcugcucua | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Cyclin D (CCND3) | Literature-reported Target | Target Info | [2] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase TRIM31 | Regulated Protein | [4] | ||
| NAD-dependent protein lipoamidase sirtuin-4, mitochondrial | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | miR-15b Inhibits the Progression of Glioblastoma Cells Through Targeting Insulin-like Growth Factor Receptor 1. Horm Cancer. 2017 Feb;8(1):49-57. | ||||
| REF 2 | Up-regulation of microRNA-15b correlates with unfavorable prognosis and malignant progression of human glioma. Int J Clin Exp Pathol. 2015 May 1;8(5):4943-52. | ||||
| REF 3 | MicroRNA-15b regulates reversion-inducing cysteine-rich protein with Kazal motifs (RECK) expression in human uterine leiomyoma. Reprod Biol Endocrinol. 2016 Aug 17;14(1):45. | ||||
| REF 4 | MicroRNA-15b Modulates Japanese Encephalitis Virus-Mediated Inflammation via Targeting RNF125.J Immunol. 2015 Sep 1;195(5):2251-62. | ||||
| REF 5 | MicroRNA-15b regulates mitochondrial ROS production and the senescence-associated secretory phenotype through sirtuin 4/SIRT4.Aging (Albany NY). 2016 Mar;8(3):484-505. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.