miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-181c-5p | ||||
| miRNA Stemloop AC | MI0000271 | ||||
| miRNA Stemloop ID | hsa-mir-181c | ||||
| Sequence | aacauucaaccugucggugagu | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Interleukin-2 (IL2) | Successful Target | Target Info | [2] | ||
| Dihydropyrimidinase related protein 2 (DPYSL2) | Successful Target | Target Info | [3] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [4] | ||
| Protein kinase C delta (PRKCD) | Clinical trial Target | Target Info | [5] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [6] | ||
| Interleukin-7 (IL7) | Clinical trial Target | Target Info | [7] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [6] | ||
| Notch-2 receptor (NOTCH2) | Clinical trial Target | Target Info | [8] | ||
| Notch-4 receptor (NOTCH4) | Clinical trial Target | Target Info | [8] | ||
| Bone morphogenetic protein receptor (BMPR2) | Literature-reported Target | Target Info | [9] | ||
| Large tumor suppressor homolog 2 (LATS2) | Literature-reported Target | Target Info | [10] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [11] | ||
| Sialyltransferase 8D (ST8SIA4) | Literature-reported Target | Target Info | [12] | ||
| Methyl cpg binding protein 2 (MECP2) | Clinical trial Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | BTB/POZ domain-containing protein 3 | Regulated Protein | [4] | ||
| Hepatocyte growth factor-like protein | Regulated Protein | [10] | |||
| Homeobox protein CDX-2 | Regulated Protein | [15] | |||
| Krueppel-like factor 6 | Regulated Protein | [16] | |||
| Phosphatidylcholine:ceramide cholinephosphotransferase 1 | Regulated Protein | [10] | |||
| Proline-rich acidic protein 1 | Regulated Protein | [17] | |||
| Protein NDRG2 | Regulated Protein | [18] | |||
| Protein salvador homolog 1 | Regulated Protein | [10] | |||
| Ras-related protein Rap-1b | Regulated Protein | [19] | |||
| Serine/threonine-protein kinase NLK | Regulated Protein | [15] | |||
| Transcription factor GATA-6 | Regulated Protein | [15] | |||
| Transforming growth factor-beta receptor-associated protein 1 | Regulated Protein | [6] | |||
| Tripartite motif-containing protein 2 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. | ||||
| REF 2 | Human activated CD4(+) T lymphocytes increase IL-2 expression by downregulating microRNA-181c. Mol Immunol. 2011 Jan;48(4):592-9. | ||||
| REF 3 | Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 2013 May 8;8(5):e62589. | ||||
| REF 4 | Target gene repression mediated by miRNAs miR-181c and miR-9 both of which are down-regulated by amyloid-. J Mol Neurosci. 2012 Feb;46(2):324-35. | ||||
| REF 5 | MiR181c inhibits ovarian cancer metastasis and progression by targeting PRKCD expression. Int J Clin Exp Med. 2015 Sep 15;8(9):15198-205. | ||||
| REF 6 | MicroRNA-181c inhibits glioblastoma cell invasion, migration and mesenchymal transition by targeting TGF- pathway. Biochem Biophys Res Commun. 2016 Jan 22;469(4):1041-8. | ||||
| REF 7 | Decreased microRNA miR-181c expression in peripheral blood mononuclear cells correlates with elevated serum levels of IL-7 and IL-17 in patients with myasthenia gravis. Clin Exp Med. 2016 Aug;16(3):413-21. | ||||
| REF 8 | Involvement of epigenetically silenced microRNA-181c in gastric carcinogenesis. Carcinogenesis. 2010 May;31(5):777-84. | ||||
| REF 9 | Roles of miR-1-1 and miR-181c in ventricular septal defects. Int J Cardiol. 2013 Sep 30;168(2):1441-6. | ||||
| REF 10 | Upregulation of miR-181c contributes to chemoresistance in pancreatic cancer by inactivating the Hippo signaling pathway. Oncotarget. 2015 Dec 29;6(42):44466-79. | ||||
| REF 11 | miR-181c promotes proliferation via suppressing PTEN expression in inflammatory breast cancer. Int J Oncol. 2015 May;46(5):2011-20. | ||||
| REF 12 | Upregulation of miR-181c inhibits chemoresistance by targeting ST8SIA4 in chronic myelocytic leukemia. Oncotarget. 2016 Sep 13;7(37):60074-60086. | ||||
| REF 13 | Target gene repression mediated by miRNAs miR-181c and miR-9 both of which are down-regulated by amyloid-. J Mol Neurosci. 2012 Feb;46(2):324-35. | ||||
| REF 14 | Upregulation of miR-181c contributes to chemoresistance in pancreatic cancer by inactivating the Hippo signaling pathway. Oncotarget. 2015 Dec 29;6(42):44466-79. | ||||
| REF 15 | Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells.Hepatology. 2009 Aug;50(2):472-80. | ||||
| REF 16 | Vitamin D manipulates miR-181c, miR-20b and miR-15a in human umbilical vein endothelial cells exposed to a diabetic-like environment.Cardiovasc Diabetol. 2014 Jan 7;13:8. | ||||
| REF 17 | MiR-10a and miR-181c regulate collagen type I generation in hypertrophic scars by targeting PAI-1 and uPA. FEBS Lett. 2015 Jan 30;589(3):380-9. | ||||
| REF 18 | N-myc downstream-regulated gene 2 inhibits human cholangiocarcinoma progression and is regulated by leukemia inhibitory factor/MicroRNA-181c negative feedback pathway.Hepatology. 2016 Nov;64(5):1606-1622. | ||||
| REF 19 | miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells.Med Oncol. 2014 Apr;31(4):892. | ||||
| REF 20 | MicroRNA-181c inhibits glioblastoma cell invasion, migration and mesenchymal transition by targeting TGF- pathway. Biochem Biophys Res Commun. 2016 Jan 22;469(4):1041-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.