miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-186-5p | ||||
| miRNA Stemloop AC | MI0000483 | ||||
| miRNA Stemloop ID | hsa-mir-186 | ||||
| Sequence | caaagaauucuccuuuugggcu | ||||
| TTD Target(s) Regulated by This miRNA | Multidrug resistance protein 1 (ABCB1) | Clinical trial Target | Target Info | [1] | |
| Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [2] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [3] | ||
| Casein kinase II alpha (CSNK2A1) | Clinical trial Target | Target Info | [4] | ||
| MAPK/ERK kinase kinase 2 (MAP3K2) | Clinical trial Target | Target Info | [5] | ||
| P2X purinoceptor 7 (P2RX7) | Clinical trial Target | Target Info | [6] | ||
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [7] | ||
| Gap junction alpha-1 protein (GJA1) | Clinical trial Target | Target Info | [8] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [9] | ||
| Lysine N-methyltransferase 3A (SETD2) | Literature-reported Target | Target Info | [9] | ||
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [10] | ||
| Protein(s) Regulated by This miRNA | A-kinase anchor protein 12 | Regulated Protein | [11] | ||
| Nicastrin | Regulated Protein | [12] | |||
| Protein phosphatase 1B | Regulated Protein | [13] | |||
| Securin | Regulated Protein | [14] | |||
| Serine/threonine-protein kinase PAK 6 | Regulated Protein | [7] | |||
| Telomeric repeat-binding factor 2-interacting protein 1 | Regulated Protein | [16] | |||
| Twist-related protein 1 | Regulated Protein | [17] | |||
| References | |||||
| REF 1 | MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. J Ovarian Res. 2015 Dec 2;8:80. | ||||
| REF 2 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 3 | Linking microsomal prostaglandin E Synthase-1/PGE-2 pathway with miR-15a and -186 expression: Novel mechanism of VEGF modulation in prostate cancer. Oncotarget. 2016 Jul 12;7(28):44350-44364. | ||||
| REF 4 | MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting subunit of protein kinase CKII in human colorectal cancer cells. Biochem Biophys Res Commun. 2012 Dec 14;429(3-4):173-9. | ||||
| REF 5 | MicroRNA-186 suppresses cell proliferation and metastasis through targeting MAP3K2 in non-small cell lung cancer. Int J Oncol. 2016 Oct;49(4):1437-44. | ||||
| REF 6 | MicroRNAs miR-186 and miR-150 down-regulate expression of the pro-apoptotic purinergic P2X7 receptor by activation of instability sites at the 3'-untranslated region of the gene that decrease steady-state levels of the transcript. J Biol Chem. 2008 Oct 17;283(42):28274-86. | ||||
| REF 7 | CRNDE affects the malignant biological characteristics of human glioma stem cells by negatively regulating miR-186. Oncotarget. 2015 Sep 22;6(28):25339-55. | ||||
| REF 8 | Identification of miR-200a as a novel suppressor of connexin 43 in breast cancer cells. Biosci Rep. 2015 Aug 17;35(5). pii: e00251. | ||||
| REF 9 | MiR-186 inhibited aerobic glycolysis in gastric cancer via HIF-1 regulation. Oncogenesis. 2016 May 9;5:e224. | ||||
| REF 10 | Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16. | ||||
| REF 11 | Down-regulation of tumor suppressor A kinase anchor protein 12 in human hepatocarcinogenesis by epigenetic mechanisms.Hepatology. 2010 Dec;52(6):2023-33. | ||||
| REF 12 | MicroRNAs targeting Nicastrin regulate A production and are affected by target site polymorphisms.Front Mol Neurosci. 2014 Jul 18;7:67. | ||||
| REF 13 | miR-186 downregulates protein phosphatase PPM1B in bladder cancer and mediates G1-S phase transition.Tumour Biol. 2016 Apr;37(4):4331-41. | ||||
| REF 14 | PTTG1 promotes migration and invasion of human non-small cell lung cancer cells and is modulated by miR-186.Carcinogenesis. 2013 Sep;34(9):2145-55. | ||||
| REF 15 | CRNDE affects the malignant biological characteristics of human glioma stem cells by negatively regulating miR-186. Oncotarget. 2015 Sep 22;6(28):25339-55. | ||||
| REF 16 | Acute exercise leads to regulation of telomere-associated genes and microRNA expression in immune cells.PLoS One. 2014 Apr 21;9(4):e92088. | ||||
| REF 17 | miR-186 affects the proliferation, invasion and migration of human gastric cancer by inhibition of Twist1.Oncotarget. 2016 Nov 29;7(48):79956-79963. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.