miRNA General Information
miRNA Mature ID	hsa-miR-192-3p
miRNA Stemloop AC	MI0000234
miRNA Stemloop ID	hsa-mir-192
Sequence	cugccaauuccauaggucacag
TTD Target(s) Regulated by This miRNA	Farnesoid X-activated receptor (FXR)	Successful Target	Target Info	[1]
References
REF 1	microRNA-192 suppresses the expression of the farnesoid X receptor. Am J Physiol Gastrointest Liver Physiol. 2016 Jun 1;310(11):G1044-51.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.