miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-193a-5p | ||||
| miRNA Stemloop AC | MI0000487 | ||||
| miRNA Stemloop ID | hsa-mir-193a | ||||
| Sequence | ugggucuuugcgggcgagauga | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [2] | ||
| Wilms tumor protein (WT1) | Clinical trial Target | Target Info | [3] | ||
| Serine Racemase (SRR) | Literature-reported Target | Target Info | [4] | ||
| AP-2 transcription factor (TFAP2A) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Inhibitor of growth protein 5 | Regulated Protein | [6] | ||
| Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [7] | |||
| Neurolysin, mitochondrial | Regulated Protein | [8] | |||
| Phosphatidylinositol 3-kinase regulatory subunit gamma | Regulated Protein | [2] | |||
| Tumor protein p73 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104. | ||||
| REF 2 | MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23. | ||||
| REF 3 | Pathologically decreased expression of miR-193a contributes to metastasis by targeting WT1-E-cadherin axis in non-small cell lung cancers. J Exp Clin Cancer Res. 2016 Nov 7;35(1):173. | ||||
| REF 4 | MiR-193a-3p and miR-193a-5p suppress the metastasis of human osteosarcoma cells by down-regulating Rab27B and SRR, respectively. Clin Exp Metastasis. 2016 Apr;33(4):359-72. | ||||
| REF 5 | MiR-193a-5p Targets the Coding Region of AP-2 mRNA and Induces Cisplatin Resistance in Bladder Cancers. J Cancer. 2016 Aug 7;7(12):1740-1746. | ||||
| REF 6 | The miR-193a-3p-regulated ING5 gene activates the DNA damage response pathway and inhibits multi-chemoresistance in bladder cancer.Oncotarget. 2015 Apr 30;6(12):10195-206. | ||||
| REF 7 | The oncogenic triangle of HMGA2, LIN28B and IGF2BP1 antagonizes tumor-suppressive actions of the let-7 family.Nucleic Acids Res. 2016 May 5;44(8):3845-64. | ||||
| REF 8 | Arm Selection Preference of MicroRNA-193a Varies in Breast Cancer. Sci Rep. 2016 Jun 16;6:28176. | ||||
| REF 9 | MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23. | ||||
| REF 10 | A microRNA-dependent program controls p53-independent survival and chemosensitivity in human and murine squamous cell carcinoma.J Clin Invest. 2011 Feb;121(2):809-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.