miRNA General Information
miRNA Mature ID	hsa-miR-195-3p
miRNA Stemloop AC	MI0000489
miRNA Stemloop ID	hsa-mir-195
Sequence	ccaauauuggcugugcugcucc
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[1]
	Fibroblast growth factor-2 (FGF2)	Successful Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Cell adhesion molecule 2	Regulated Protein	CADM2_HUMAN	[1]
	Clathrin heavy chain 1	Regulated Protein	CLH1_HUMAN	[1]
	Cullin-2	Regulated Protein	CUL2_HUMAN	[1]
	Desmocollin-3	Regulated Protein	DSC3_HUMAN	[1]
	Mitofusin-2	Regulated Protein	MFN2_HUMAN	[4]
	Polyadenylate-binding protein-interacting protein 2	Regulated Protein	PAIP2_HUMAN	[1]
	Probable bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase 2	Regulated Protein	MTD2L_HUMAN	[1]
	Ras-related protein Rab-6A	Regulated Protein	RAB6A_HUMAN	[1]
	SUMO-conjugating enzyme UBC9	Regulated Protein	UBC9_HUMAN	[1]
References
REF 1	Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.
REF 2	miR-195 Inhibits EMT by Targeting FGF2 in Prostate Cancer Cells. PLoS One. 2015 Dec 9;10(12):e0144073.
REF 3	Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.
REF 4	MiR-195 dependent roles of mitofusin2 in the mitochondrial dysfunction of hippocampal neurons in SAMP8 mice.Brain Res. 2016 Dec 1;1652:135-143.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.