miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-197-3p | ||||
| miRNA Stemloop AC | MI0000239 | ||||
| miRNA Stemloop ID | hsa-mir-197 | ||||
| Sequence | uucaccaccuucuccacccagc | ||||
| TTD Target(s) Regulated by This miRNA | Extracellular signal-regulated kinase 2 (ERK2) | Clinical trial Target | Target Info | [1] | |
| Interleukin-18 (IL18) | Clinical trial Target | Target Info | [2] | ||
| Tumor suppressor candidate 2 (TUSC2) | Clinical trial Target | Target Info | [3] | ||
| Activin receptor-like kinase 2 (ALK-2) | Clinical trial Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Alpha-1-antichymotrypsin | Regulated Protein | [5] | ||
| Bcl-2-modifying factor | Regulated Protein | [6] | |||
| C-1-tetrahydrofolate synthase, cytoplasmic | Regulated Protein | [7] | |||
| CD82 antigen | Regulated Protein | [8] | |||
| CD82 antigen | Regulated Protein | [9] | |||
| Forkhead box protein J2 | Regulated Protein | [10] | |||
| Forkhead box protein O3 | Regulated Protein | [11] | |||
| GTP-binding nuclear protein Ran | Regulated Protein | [12] | |||
| Phorbol-12-myristate-13-acetate-induced protein 1 | Regulated Protein | [6] | |||
| Probable 28S rRNA (cytosine-C(5))-methyltransferase | Regulated Protein | [13] | |||
| Serine/threonine-protein kinase WNK1 | Regulated Protein | [14] | |||
| Tetraspanin-3 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | MicroRNA 97 reverses the drug resistance of fluorouracilnduced SGC7901 cells by targeting mitogenctivated protein kinase 1. Mol Med Rep. 2015 Oct;12(4):5019-25. | ||||
| REF 2 | miR-197 Expression in Peripheral Blood Mononuclear Cells from Hepatitis B Virus-Infected Patients. Gut Liver. 2013 May;7(3):335-42. | ||||
| REF 3 | miR-93, miR-98, and miR-197 regulate expression of tumor suppressor gene FUS1. Mol Cancer Res. 2009 Aug;7(8):1234-43. | ||||
| REF 4 | A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91. | ||||
| REF 5 | Human microRNA expression in sporadic and FAP-associated desmoid tumors and correlation with beta-catenin mutations.Oncotarget. 2017 Jun 27;8(26):41866-41875. | ||||
| REF 6 | Antitumor effect of miR-197 targeting in p53 wild-type lung cancer.Cell Death Differ. 2014 May;21(5):774-82. | ||||
| REF 7 | An NTD-associated polymorphism in the 3' UTR of MTHFD1L can affect disease risk by altering miRNA binding.Hum Mutat. 2014 Jan;35(1):96-104. | ||||
| REF 8 | Nuclear Drosha enhances cell invasion via an EGFR-ERK1/2-MMP7 signaling pathway induced by dysregulated miRNA-622/197 and their targets LAMC2 and CD82 in gastric cancer. Cell Death Dis. 2017 Mar 2;8(3):e2642. | ||||
| REF 9 | Anti-miR-197 inhibits migration in HCC cells by targeting KAI 1/CD82.Biochem Biophys Res Commun. 2014 Apr 4;446(2):541-8. | ||||
| REF 10 | STAT6 silencing up-regulates cholesterol synthesis via miR-197/FOXJ2 axis and induces ER stress-mediated apoptosis in lung cancer cells.Biochim Biophys Acta. 2015 Jan;1849(1):32-43. | ||||
| REF 11 | Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget. 2015 Dec 22;6(41):43819-30. | ||||
| REF 12 | Host MicroRNA miR-197 Plays a Negative Regulatory Role in the Enterovirus 71 Infectious Cycle by Targeting the RAN Protein.J Virol. 2015 Nov 18;90(3):1424-38. | ||||
| REF 13 | miR-197 induces epithelial-mesenchymal transition in pancreatic cancer cells by targeting p120 catenin.J Cell Physiol. 2013 Jun;228(6):1255-63. | ||||
| REF 14 | Messenger RNA and MicroRNA transcriptomic signatures of cardiometabolic risk factors.BMC Genomics. 2017 Feb 8;18(1):139. | ||||
| REF 15 | A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.