miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-199b-5p | ||||
| miRNA Stemloop AC | MI0000282 | ||||
| miRNA Stemloop ID | hsa-mir-199b | ||||
| Sequence | cccaguguuuagacuaucuguuc | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Tyrosine-protein kinase Kit (KIT) | Successful Target | Target Info | [2] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [3] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [4] | ||
| Epithelial discoidin domain receptor 1 (DDR1) | Patented-recorded Target | Target Info | [5] | ||
| Lysine N-methyltransferase 3A (SETD2) | Literature-reported Target | Target Info | [6] | ||
| Laminin gamma-2 subunit (LAMC2) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Cyclin-L1 | Regulated Protein | [2] | ||
| Growth factor receptor-bound protein 10 | Regulated Protein | [2] | |||
| Integrin alpha-3 | Regulated Protein | [9] | |||
| Podocalyxin | Regulated Protein | [5] | |||
| Protein jagged-1 | Regulated Protein | [11] | |||
| Protein SET | Regulated Protein | [12] | |||
| Serine/threonine-protein kinase NLK | Regulated Protein | [2] | |||
| Transcription factor HES-1 | Regulated Protein | [13] | |||
| Transcription initiation factor TFIID subunit 9B | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | MiR-199b-5p targets HER2 in breast cancer cells. J Cell Biochem. 2013 Jul;114(7):1457-63. | ||||
| REF 2 | The up-regulation of miR-199b-5p in erythroid differentiation is associated with GATA-1 and NF-E2. Mol Cells. 2014 Mar;37(3):213-9. | ||||
| REF 3 | Downregulation of miR-199b is associated with distant metastasis in colorectal cancer via activation of SIRT1 and inhibition of CREB/KISS1 signaling. Oncotarget. 2016 Jun 7;7(23):35092-105. | ||||
| REF 4 | Underexpressed microRNA-199b-5p targets hypoxia-inducible factor-1 in hepatocellular carcinoma and predicts prognosis of hepatocellular carcinoma patients. J Gastroenterol Hepatol. 2011 Nov;26(11):1630-7. | ||||
| REF 5 | miR-199b-5p directly targets PODXL and DDR1 and decreased levels of miR-199b-5p correlate with elevated expressions of PODXL and DDR1 in acute myeloid leukemia. Am J Hematol. 2012 Apr;87(4):442-6. | ||||
| REF 6 | MiR199b suppresses expression of hypoxia-inducible factor 1 (HIF-1) in prostate cancer cells. Int J Mol Sci. 2013 Apr 17;14(4):8422-36. | ||||
| REF 7 | A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78. | ||||
| REF 8 | The up-regulation of miR-199b-5p in erythroid differentiation is associated with GATA-1 and NF-E2. Mol Cells. 2014 Mar;37(3):213-9. | ||||
| REF 9 | Regulation of ITGA3 by the dual-stranded microRNA-199 family as a potential prognostic marker in bladder cancer.Br J Cancer. 2017 Apr 11;116(8):1077-1087. | ||||
| REF 10 | miR-199b-5p directly targets PODXL and DDR1 and decreased levels of miR-199b-5p correlate with elevated expressions of PODXL and DDR1 in acute myeloid leukemia. Am J Hematol. 2012 Apr;87(4):442-6. | ||||
| REF 11 | Epigenetic silencing of microRNA-199b-5p is associated with acquired chemoresistance via activation of JAG1-Notch1 signaling in ovarian cancer.Oncotarget. 2014 Feb 28;5(4):944-58. | ||||
| REF 12 | Decreased expression of microRNA-199b increases protein levels of SET (protein phosphatase 2A inhibitor) in human choriocarcinoma.Cancer Lett. 2010 May 1;291(1):99-107. | ||||
| REF 13 | MicroRNA-199b-5p impairs cancer stem cells through negative regulation of HES1 in medulloblastoma.PLoS One. 2009;4(3):e4998. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.