miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-19a-5p | ||||
| miRNA Stemloop AC | MI0000073 | ||||
| miRNA Stemloop ID | hsa-mir-19a | ||||
| Sequence | aguuuugcauaguugcacuaca | ||||
| TTD Target(s) Regulated by This miRNA | Zinc finger protein A20 (TNFAIP3) | Literature-reported Target | Target Info | [1] | |
| B-cell translocation gene 1 protein (BTG1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Metalloproteinase inhibitor 1 | Regulated Protein | [3] | ||
| Nucleolysin TIA-1 isoform p40 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | miR-19a promotes colitis-associated colorectal cancer by regulating tumor necrosis factor alpha-induced protein 3-NF-B feedback loops. Oncogene. 2017 Jun 8;36(23):3240-3251. | ||||
| REF 2 | MicroRNA-19a regulates proliferation and apoptosis of castration-resistant prostate cancer cells by targeting BTG1. FEBS Lett. 2015 Jun 4;589(13):1485-90. | ||||
| REF 3 | ANT2 shRNA downregulates miR-19a and miR-96 through the PI3K/Akt pathway and suppresses tumor growth in hepatocellular carcinoma cells.Exp Mol Med. 2016 Mar 25;48:e222. | ||||
| REF 4 | miR-19a promotes colorectal cancer proliferation and migration by targeting TIA1.Mol Cancer. 2017 Mar 4;16(1):53. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.