miRNA General Information
miRNA Mature ID	hsa-miR-19b-1-5p
miRNA Stemloop AC	MI0000074
miRNA Stemloop ID	hsa-mir-19b-1
Sequence	aguuuugcagguuugcauccagc
TTD Target(s) Regulated by This miRNA	Fibroblast growth factor receptor 2 (FGFR2)	Successful Target	Target Info	[1]
	Vascular endothelial growth factor receptor 2 (KDR)	Successful Target	Target Info	[1]
	G1/S-specific cyclin-D1 (CCND1)	Clinical trial Target	Target Info	[1]
	Caspase-8 (CASP8)	Patented-recorded Target	Target Info	[1]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[2]
	Integrin beta-8 (ITGB8)	Clinical trial Target	Target Info	[1]
References
REF 1	MiR-19b-1 inhibits angiogenesis by blocking cell cycle progression of endothelial cells. Biochem Biophys Res Commun. 2012 Jan 13;417(2):771-6.
REF 2	Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.