miRNA General Information
miRNA Mature ID	hsa-miR-19b-3p
miRNA Stemloop AC	MI0000074 | MI0000075
miRNA Stemloop ID	hsa-mir-19b-1 | hsa-mir-19b-2
Sequence	ugugcaaauccaugcaaaacuga
TTD Target(s) Regulated by This miRNA	Estrogen receptor (ESR)	Successful Target	Target Info	[1]
Protein(s) Regulated by This miRNA	5'-AMP-activated protein kinase catalytic subunit alpha-1	Regulated Protein	AAPK1_HUMAN	[2]
	Alpha-ketoglutarate-dependent dioxygenase alkB homolog 6	Regulated Protein	ALKB6_HUMAN	[3]
	AT-rich interactive domain-containing protein 4B	Regulated Protein	ARI4B_HUMAN	[4]
	Ataxin-1	Regulated Protein	ATX1_HUMAN	[5]
	ATP-binding cassette sub-family A member 2	Regulated Protein	ABCA2_HUMAN	[3]
	B-cell lymphoma 3 protein	Regulated Protein	BCL3_HUMAN	[6]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[7]
	Butyrophilin subfamily 2 member A2	Regulated Protein	BT2A2_HUMAN	[3]
	Calsequestrin-1	Regulated Protein	CASQ1_HUMAN	[3]
	Chorion-specific transcription factor GCMa	Regulated Protein	GCM1_HUMAN	[8]
	Cullin-5	Regulated Protein	CUL5_HUMAN	[9]
	E3 ubiquitin-protein ligase MYLIP	Regulated Protein	MYLIP_HUMAN	[4]
	G protein-coupled receptor kinase 4	Regulated Protein	GRK4_HUMAN	[3]
	GTP-binding protein REM 1	Regulated Protein	REM1_HUMAN	[3]
	Histone acetyltransferase KAT2A	Regulated Protein	KAT2A_HUMAN	[3]
	Homeobox protein PKNOX1	Regulated Protein	PKNX1_HUMAN	[10]
	Homeodomain-interacting protein kinase 1	Regulated Protein	HIPK1_HUMAN	[11]
	Homeodomain-interacting protein kinase 3	Regulated Protein	HIPK3_HUMAN	[4]
	Hsc70-interacting protein	Regulated Protein	F10A1_HUMAN	[3]
	Max dimerization protein 1	Regulated Protein	MAD1_HUMAN	[12]
	Mediator of RNA polymerase II transcription subunit 28	Regulated Protein	MED28_HUMAN	[3]
	Microtubule-associated tumor suppressor 1	Regulated Protein	MTUS1_HUMAN	[13]
	Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[14]
	Myb-related protein B	Regulated Protein	MYBB_HUMAN	[3]
	NEDD4 family-interacting protein 1	Regulated Protein	NFIP1_HUMAN	[3]
	Pituitary homeobox 1	Regulated Protein	PITX1_HUMAN	[15]
	Piwi-like protein 4	Regulated Protein	PIWL4_HUMAN	[3]
	Pregnancy-specific beta-1-glycoprotein 4	Regulated Protein	PSG4_HUMAN	[3]
	Protein FAM218A	Regulated Protein	F218A_HUMAN	[3]
	Rho guanine nucleotide exchange factor 28	Regulated Protein	ARG28_HUMAN	[3]
	Ribonuclease pancreatic	Regulated Protein	RNAS1_HUMAN	[3]
	Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit epsilon isoform	Regulated Protein	2A5E_HUMAN	[2]
	Signal-regulatory protein beta-2	Regulated Protein	SIRB2_HUMAN	[3]
	Small G protein signaling modulator 3	Regulated Protein	SGSM3_HUMAN	[3]
	Tetratricopeptide repeat protein 9C	Regulated Protein	TTC9C_HUMAN	[3]
	Transcriptional protein SWT1	Regulated Protein	SWT1_HUMAN	[3]
	Transmembrane protein 107	Regulated Protein	TM107_HUMAN	[3]
	Ubiquitin carboxyl-terminal hydrolase 34	Regulated Protein	UBP34_HUMAN	[3]
	WD repeat and FYVE domain-containing protein 2	Regulated Protein	WDFY2_HUMAN	[3]
	Zinc finger protein 772	Regulated Protein	ZN772_HUMAN	[3]
References
REF 1	The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2	Genome-wide RNA-mediated interference screen identifies miR-19 targets in Notch-induced T-cell acute lymphoblastic leukaemia.Nat Cell Biol. 2010 Apr;12(4):372-9.
REF 3	Role of miR-19b and its target mRNAs in 5-fluorouracil resistance in colon cancer cells.J Gastroenterol. 2012 Aug;47(8):883-95.
REF 4	Oncogenic potential of the miR-106-363 cluster and its implication in human T-cell leukemia.Cancer Res. 2007 Jun 15;67(12):5699-707.
REF 5	miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis.Nat Neurosci. 2008 Oct;11(10):1137-9.
REF 6	MicroRNA-19b inhibits proliferation of gastric cancer cells by targeting B-cell CLL/lymphoma 3.Oncol Rep. 2016 Oct;36(4):2079-86.
REF 7	MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 8	The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. Mol Cell Biol. 2013 May;33(9):1782-96.
REF 9	MicroRNA-19a and -19b regulate cervical carcinoma cell proliferation and invasion by targeting CUL5.Cancer Lett. 2012 Sep 28;322(2):148-58.
REF 10	The miR-17 2 cluster contributes to MLL leukemia through the repression of MEIS1 competitor PKNOX1.Leuk Res. 2016 Jul;46:51-60.
REF 11	MiR-19b/20a/92a regulates the self-renewal and proliferation of gastric cancer stem cells. J Cell Sci. 2013 Sep 15;126(Pt 18):4220-9.
REF 12	MiR-19a/b modulate the metastasis of gastric cancer cells by targeting the tumour suppressor MXD1.Cell Death Dis. 2014 Mar 27;5:e1144.
REF 13	Oncogenic miR-19a and miR-19b co-regulate tumor suppressor MTUS1 to promote cell proliferation and migration in lung cancer.Protein Cell. 2017 Jun;8(6):455-466.
REF 14	High iodine blocks a Notch/miR-19 loop activated by the BRAF(V600E) oncoprotein and restores the response to TGF in thyroid follicular cells.Thyroid. 2014 Mar;24(3):453-62.
REF 15	miR-19b regulates hTERT mRNA expression through targeting PITX1 mRNA in melanoma cells.Sci Rep. 2015 Feb 3;5:8201.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.