miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-208b-3p | ||||
| miRNA Stemloop AC | MI0005570 | ||||
| miRNA Stemloop ID | hsa-mir-208b | ||||
| Sequence | auaagacgaacaaaagguuugu | ||||
| TTD Target(s) Regulated by This miRNA | Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) | Successful Target | Target Info | [1] | |
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Protein quaking | Regulated Protein | [3] | ||
| Voltage-dependent L-type calcium channel subunit beta-2 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | miR-208b upregulation interferes with calcium handling in HL-1 atrial myocytes: Implications in human chronic atrial fibrillation. J Mol Cell Cardiol. 2016 Oct;99:162-173. | ||||
| REF 2 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 3 | Extracellular vesicles-mediated transfer of miR-208a/b exaggerate hypoxia/reoxygenation injury in cardiomyocytes by reducing QKI expression.Mol Cell Biochem. 2017 Jul;431(1-2):187-195. | ||||
| REF 4 | miR-208b upregulation interferes with calcium handling in HL-1 atrial myocytes: Implications in human chronic atrial fibrillation. J Mol Cell Cardiol. 2016 Oct;99:162-173. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.