miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-28-5p | ||||
| miRNA Stemloop AC | MI0000086 | ||||
| miRNA Stemloop ID | hsa-mir-28 | ||||
| Sequence | aaggagcucacagucuauugag | ||||
| TTD Target(s) Regulated by This miRNA | Thrombopoietin receptor (MPL) | Successful Target | Target Info | [1] | |
| Extracellular signal-regulated kinase 2 (ERK2) | Clinical trial Target | Target Info | [1] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [2] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [3] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | BAG family molecular chaperone regulator 1 | Regulated Protein | [5] | ||
| Interleukin-34 | Regulated Protein | [6] | |||
| Mitotic spindle assembly checkpoint protein MAD2A | Regulated Protein | [5] | |||
| NEDD4-binding protein 1 | Regulated Protein | [1] | |||
| Protein TEX261 | Regulated Protein | [1] | |||
| Ras-related protein Rap-1b | Regulated Protein | [5] | |||
| Ras-related protein Rap-1b | Regulated Protein | [8] | |||
| Signal transducer and activator of transcription 5B | Regulated Protein | [2] | |||
| Transcription factor E2F6 | Regulated Protein | [1] | |||
| Ubiquitin thioesterase OTUB1 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 2 | Persistent STAT5 activation in myeloid neoplasms recruits p53 into gene regulation. Oncogene. 2015 Mar 5;34(10):1323-32. | ||||
| REF 3 | Down-regulated miR-28-5p in human hepatocellular carcinoma correlated with tumor proliferation and migration by targeting insulin-like growth factor-1 (IGF-1). Mol Cell Biochem. 2015 Oct;408(1-2):283-93. | ||||
| REF 4 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 5 | MicroRNA 28 controls cell proliferation and is down-regulated in B-cell lymphomas.Proc Natl Acad Sci U S A. 2014 Jun 3;111(22):8185-90. | ||||
| REF 6 | miR-28-5p-IL-34-macrophage feedback loop modulates hepatocellular carcinoma metastasis.Hepatology. 2016 May;63(5):1560-75. | ||||
| REF 7 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 8 | miR-28-5p acts as a tumor suppressor in renal cell carcinoma for multiple antitumor effects by targeting RAP1B.Oncotarget. 2016 Nov 8;7(45):73888-73902. | ||||
| REF 9 | Persistent STAT5 activation in myeloid neoplasms recruits p53 into gene regulation. Oncogene. 2015 Mar 5;34(10):1323-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.