miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-298 | ||||
| miRNA Stemloop AC | MI0005523 | ||||
| miRNA Stemloop ID | hsa-mir-298 | ||||
| Sequence | agcagaagcagggagguucuccca | ||||
| TTD Target(s) Regulated by This miRNA | Beta-secretase 1 (BACE1) | Clinical trial Target | Target Info | [1] | |
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Apoptosis regulator BAX | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MicroRNA-21 is overexpressed in pancreatic cancer and a potential predictor of survival. J Gastrointest Surg. 2008 Dec;12(12):2171-6. | ||||
| REF 2 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 3 | Bufalin promotes apoptosis of gastric cancer by down-regulation of miR-298 targeting bax. Int J Clin Exp Med. 2015 Mar 15;8(3):3420-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.