miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-301a-3p | ||||
| miRNA Stemloop AC | MI0000745 | ||||
| miRNA Stemloop ID | hsa-mir-301a | ||||
| Sequence | cagugcaauaguauugucaaagc | ||||
| TTD Target(s) Regulated by This miRNA | Endothelial plasminogen activator inhibitor (SERPINE1) | Clinical trial Target | Target Info | [1] | |
| Apoptosis signal-regulating kinase 1 (MAP3K5) | Clinical trial Target | Target Info | [2] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [3] | ||
| Runt-related transcription factor 3 (RUNX3) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [5] | ||
| Dual specificity protein phosphatase CDC14A | Regulated Protein | [6] | |||
| Homeobox protein MOX-2 | Regulated Protein | [7] | |||
| Metalloproteinase inhibitor 2 | Regulated Protein | [8] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [9] | |||
| NF-kappa-B-repressing factor | Regulated Protein | [10] | |||
| Smad nuclear-interacting protein 1 | Regulated Protein | [11] | |||
| UV radiation resistance-associated gene protein | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | Involvement of miR-30c and miR-301a in immediate induction of plasminogen activator inhibitor-1 by placental growth factor in human pulmonary endothelial cells. Biochem J. 2011 Mar 15;434(3):473-82. | ||||
| REF 2 | MicroRNA-Mediated Down-Regulation of Apoptosis Signal-Regulating Kinase 1 (ASK1) Attenuates the Apoptosis of Human Mesenchymal Stem Cells (MSCs) Transplanted into Infarcted Heart. Int J Mol Sci. 2016 Oct 20;17(10). pii: E1752. | ||||
| REF 3 | Upregulated microRNA-301a in breast cancer promotes tumor metastasis by targeting PTEN and activating Wnt/-catenin signaling. Gene. 2014 Feb 10;535(2):191-7. | ||||
| REF 4 | Overexpressed miR-301a promotes cell proliferation and invasion by targeting RUNX3 in gastric cancer. J Gastroenterol. 2013 Sep;48(9):1023-33. | ||||
| REF 5 | miR-301a promotes pancreatic cancer cell proliferation by directly inhibiting Bim expression.J Cell Biochem. 2012 Oct;113(10):3229-35. | ||||
| REF 6 | Upregulated microRNA-301a in osteosarcoma promotes tumor progression by targeting CDC14A. Genet Mol Res. 2016 May 23;15(2). | ||||
| REF 7 | Intronic miR-301 feedback regulates its host gene, ska2, in A549 cells by targeting MEOX2 to affect ERK/CREB pathways.Biochem Biophys Res Commun. 2010 Jun 11;396(4):978-82. | ||||
| REF 8 | MiR-301a promotes cell proliferation by directly targeting TIMP2 in multiple myeloma. Int J Clin Exp Pathol. 2015 Aug 1;8(8):9168-74. | ||||
| REF 9 | The oncogenic role of microRNA-130a/301a/454 in human colorectal cancer via targeting Smad4 expression.PLoS One. 2013;8(2):e55532. | ||||
| REF 10 | miR-301a as an NF-B activator in pancreatic cancer cells.EMBO J. 2011 Jan 5;30(1):57-67. | ||||
| REF 11 | miR-301a promotes intestinal mucosal inflammation through induction of IL-17A and TNF- in IBD.Gut. 2016 Dec;65(12):1938-1950. | ||||
| REF 12 | MiR-301a regulates E-cadherin expression and is predictive of prostate cancer recurrence.Prostate. 2016 Jul;76(10):869-84. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.