miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-330-5p | ||||
| miRNA Stemloop AC | MI0000803 | ||||
| miRNA Stemloop ID | hsa-mir-330 | ||||
| Sequence | ucucugggccugugucuuaggc | ||||
| TTD Target(s) Regulated by This miRNA | Tyrosinase (TYR) | Successful Target | Target Info | [1] | |
| Phosphodiesterase 4B (PDE4B) | Clinical trial Target | Target Info | [2] | ||
| Integrin alpha-5 (ITGA5) | Clinical trial Target | Target Info | [3] | ||
| Mucin-1 (MUC1) | Clinical trial Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Protein disulfide-isomerase A3 | Regulated Protein | [1] | ||
| References | |||||
| REF 1 | MiR-330-5p regulates tyrosinase and PDIA3 expression and suppresses cell proliferation and invasion in cutaneous malignant melanoma. J Surg Res. 2016 Jun 15;203(2):434-40. | ||||
| REF 2 | The microRNA network is altered in anterior cingulate cortex of patients with unipolar and bipolar depression. J Psychiatr Res. 2016 Nov;82:58-67. | ||||
| REF 3 | miR-330-5p suppresses glioblastoma cell proliferation and invasiveness through targeting ITGA5. Biosci Rep. 2017 Jun 21;37(3). pii: BSR20170019. | ||||
| REF 4 | Micro-RNAs miR-29a and miR-330-5p function as tumor suppressors by targeting the MUC1 mucin in pancreatic cancer cells. Biochim Biophys Acta. 2015 Oct;1853(10 Pt A):2392-403. | ||||
| REF 5 | MiR-330-5p regulates tyrosinase and PDIA3 expression and suppresses cell proliferation and invasion in cutaneous malignant melanoma. J Surg Res. 2016 Jun 15;203(2):434-40. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.