miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-335-3p | ||||
| miRNA Stemloop AC | MI0000816 | ||||
| miRNA Stemloop ID | hsa-mir-335 | ||||
| Sequence | uuuuucauuauugcuccugacc | ||||
| TTD Target(s) Regulated by This miRNA | Nitric-oxide synthase endothelial (NOS3) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Paired box protein Pax-6 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MicroRNA-335 and -543 suppress bone metastasis in prostate cancer via targeting endothelial nitric oxide synthase. Int J Mol Med. 2015 Nov;36(5):1417-25. | ||||
| REF 2 | microRNA-335 inhibits proliferation, cell-cycle progression, colony formation, and invasion via targeting PAX6 in breast cancer cells.Mol Med Rep. 2015 Jan;11(1):379-85. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.