miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-335-5p
miRNA Stemloop AC MI0000816
miRNA Stemloop ID hsa-mir-335
Sequence ucaagagcaauaacgaaaaaugu
TTD Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [1]
Poly [ADP-ribose] polymerase 1 (PARP1) Successful Target Target Info [2]
C-X-C chemokine receptor type 4 (CXCR4) Successful Target Target Info [3]
Urokinase plasminogen activator surface receptor (PLAUR) Successful Target Target Info [3]
Rho-associated protein kinase 1 (ROCK1) Successful Target Target Info [4]
Extracellular signal-regulated kinase 2 (ERK2) Clinical trial Target Target Info [5]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [6]
Apoptosis regulator Bcl-W (BCL-W) Clinical trial Target Target Info [7]
Tyrosine-protein kinase Mer (MERTK) Clinical trial Target Target Info [8]
Dickkopf-related protein 1 (DKK1) Clinical trial Target Target Info [9]
Tenascin (TNC) Clinical trial Target Target Info [10]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [11]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [8]
Metabotropic glutamate receptor 4 (mGluR4) Literature-reported Target Target Info [12]
GTPase activating protein (RASA1) Literature-reported Target Target Info [13]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [14]
Disheveled-associated activator of morphogenesis 2 (DAAM2) Literature-reported Target Target Info [15]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [16]
Protein(s) Regulated by This miRNA Actin-related protein 2/3 complex subunit 5-like protein Regulated Protein
ARP5L_HUMAN
[17]
Breast cancer type 1 susceptibility protein Regulated Protein
BRCA1_HUMAN
[11]
Crk-like protein Regulated Protein
CRKL_HUMAN
[19]
DNA-binding protein inhibitor ID-4 Regulated Protein
ID4_HUMAN
[11]
E3 ubiquitin-protein ligase SIAH2 Regulated Protein
SIAH2_HUMAN
[20]
Epsin-2 Regulated Protein
EPN2_HUMAN
[11]
Formin-2 Regulated Protein
FMN2_HUMAN
[15]
Formin-like protein 3 Regulated Protein
FMNL3_HUMAN
[15]
Hepatocyte nuclear factor 3-beta Regulated Protein
FOXA2_HUMAN
[22]
Leucine-rich alpha-2-glycoprotein Regulated Protein
A2GL_HUMAN
[5]
NEDD8-conjugating enzyme UBE2F Regulated Protein
UBE2F_HUMAN
[8]
POU domain, class 5, transcription factor 1 Regulated Protein
PO5F1_HUMAN
[25]
Receptor-type tyrosine-protein phosphatase N2 Regulated Protein
PTPR2_HUMAN
[8]
Retinoblastoma-associated protein Regulated Protein
RB_HUMAN
[26]
Transcription elongation factor A protein-like 9 Regulated Protein
TCAL9_HUMAN
[27]
Transcription factor SOX-17 Regulated Protein
SOX17_HUMAN
[22]
Transcription factor SOX-4 Regulated Protein
SOX4_HUMAN
[8]
Trefoil factor 2 Regulated Protein
TFF2_HUMAN
[7]
Tripartite motif-containing protein 29 Regulated Protein
TRI29_HUMAN
[29]
References
REF 1 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 2 MiR-335 regulates the chemo-radioresistance of small cell lung cancer cells by targeting PARP-1. Gene. 2017 Feb 5;600:9-15.
REF 3 Urokinase receptor and CXCR4 are regulated by common microRNAs in leukaemia cells. J Cell Mol Med. 2015 Sep;19(9):2262-72.
REF 4 miR-335 suppresses migration and invasion by targeting ROCK1 in osteosarcoma cells. Mol Cell Biochem. 2013 Dec;384(1-2):105-11.
REF 5 MiRNA-335 suppresses neuroblastoma cell invasiveness by direct targeting of multiple genes from the non-canonical TGF- signalling pathway. Carcinogenesis. 2012 May;33(5):976-85.
REF 6 Genetic variation in a miR-335 binding site in BIRC5 alters susceptibility to lung cancer in Chinese Han populations. Biochem Biophys Res Commun. 2013 Jan 11;430(2):529-34.
REF 7 MicroRNA-335 acts as a metastasis suppressor in gastric cancer by targeting Bcl-w and specificity protein 1. Oncogene. 2012 Mar 15;31(11):1398-407.
REF 8 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
REF 9 MicroRNA-335-5p inhibits osteoblast apoptosis induced by high glucose. Mol Med Rep. 2016 May;13(5):4108-12.
REF 10 miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis. Surgery. 2013 Aug;154(2):226-33.
REF 11 MicroRNA miR-335 is crucial for the BRCA1 regulatory cascade in breast cancer development. Int J Cancer. 2011 Dec 15;129(12):2797-806.
REF 12 MiR-335 is involved in major depression disorder and antidepressant treatment through targeting GRM4. Neurosci Lett. 2015 Oct 8;606:167-72.
REF 13 Methylation-associated silencing of MicroRNA-335 contributes tumor cell invasion and migration by interacting with RASA1 in gastric cancer. Am J Cancer Res. 2014 Nov 19;4(6):648-62.
REF 14 MicroRNA-335 inhibits invasion and metastasis of colorectal cancer by targeting ZEB2. Med Oncol. 2014 Jun;31(6):982.
REF 15 Metastasis suppressor microRNA-335 targets the formin family of actin nucleators. PLoS One. 2013 Nov 5;8(11):e78428.
REF 16 miR-335 orchestrates cell proliferation, migration and differentiation in human mesenchymal stem cells. Cell Death Differ. 2011 Jun;18(6):985-95.
REF 17 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 18 MicroRNA miR-335 is crucial for the BRCA1 regulatory cascade in breast cancer development. Int J Cancer. 2011 Dec 15;129(12):2797-806.
REF 19 Up-regulation of CRKL by microRNA-335 methylation is associated with poor prognosis in gastric cancer.Cancer Cell Int. 2017 Feb 16;17:28.
REF 20 miR-335 Targets SIAH2 and Confers Sensitivity to Anti-Cancer Drugs by Increasing the Expression of HDAC3. Mol Cells. 2015 Jun;38(6):562-72.
REF 21 Metastasis suppressor microRNA-335 targets the formin family of actin nucleators. PLoS One. 2013 Nov 5;8(11):e78428.
REF 22 miR-335 promotes mesendodermal lineage segregation and shapes a transcription factor gradient in the endoderm.Development. 2014 Feb;141(3):514-25.
REF 23 MiRNA-335 suppresses neuroblastoma cell invasiveness by direct targeting of multiple genes from the non-canonical TGF- signalling pathway. Carcinogenesis. 2012 May;33(5):976-85.
REF 24 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
REF 25 MiR-335 functions as a tumor suppressor in pancreatic cancer by targeting OCT4.Tumour Biol. 2014 Aug;35(8):8309-18.
REF 26 miR-335 directly targets Rb1 (pRb/p105) in a proximal connection to p53-dependent stress response.Cancer Res. 2010 Sep 1;70(17):6925-33.
REF 27 WW domain binding protein 5 induces multidrug resistance of small cell lung cancer under the regulation of miR-335 through the Hippo pathway.Br J Cancer. 2016 Jul 12;115(2):243-51.
REF 28 MicroRNA-335 acts as a metastasis suppressor in gastric cancer by targeting Bcl-w and specificity protein 1. Oncogene. 2012 Mar 15;31(11):1398-407.
REF 29 Upregulated TRIM29 promotes proliferation and metastasis of nasopharyngeal carcinoma via PTEN/AKT/mTOR signal pathway.Oncotarget. 2016 Mar 22;7(12):13634-50.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.