miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-338-5p | ||||
| miRNA Stemloop AC | MI0000814 | ||||
| miRNA Stemloop ID | hsa-mir-338 | ||||
| Sequence | aacaauauccuggugcugagug | ||||
| TTD Target(s) Regulated by This miRNA | Neuropilin-1 (NRP1) | Successful Target | Target Info | [1] | |
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [2] | ||
| Lysophosphatidic acid receptor 1 (LPAR1) | Clinical trial Target | Target Info | [3] | ||
| LDL receptor related protein-1 (LRP-1) | Literature-reported Target | Target Info | [4] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | EGF-containing fibulin-like extracellular matrix protein 1 | Regulated Protein | [6] | ||
| Protein sprouty homolog 1 | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | MiR-338 suppresses the growth and metastasis of OSCC cells by targeting NRP1. Mol Cell Biochem. 2015 Jan;398(1-2):115-22. | ||||
| REF 2 | Mycobacteria-responsive sonic hedgehog signaling mediates programmed death-ligand 1- and prostaglandin E2-induced regulatory T cell expansion. Sci Rep. 2016 Apr 15;6:24193. | ||||
| REF 3 | MiR-338* suppresses fibrotic pathogenesis in pulmonary fibrosis through targeting LPA1. Am J Transl Res. 2016 Jul 15;8(7):3197-205. | ||||
| REF 4 | MicroRNA-205 inhibits tumor cell migration through down-regulating the expression of the LDL receptor-related protein 1. Biochem Biophys Res Commun. 2009 Oct 16;388(2):400-5. | ||||
| REF 5 | Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86. | ||||
| REF 6 | MiR-338-5p suppresses proliferation, migration, invasion, and promote apoptosis of glioblastoma cells by directly targeting EFEMP1.Biomed Pharmacother. 2017 May;89:957-965. | ||||
| REF 7 | MiR-338-5p Promotes Inflammatory Response of Fibroblast-Like Synoviocytes in Rheumatoid Arthritis via Targeting SPRY1.J Cell Biochem. 2017 Aug;118(8):2295-2301. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.