miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-339-5p | ||||
| miRNA Stemloop AC | MI0000815 | ||||
| miRNA Stemloop ID | hsa-mir-339 | ||||
| Sequence | ucccuguccuccaggagcucacg | ||||
| TTD Target(s) Regulated by This miRNA | Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [1] | |
| Beta-secretase 1 (BACE1) | Clinical trial Target | Target Info | [2] | ||
| Protein tyrosine phosphatase IVA 1 (PRL-1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | B-cell lymphoma 6 protein | Regulated Protein | [4] | ||
| RNA-binding protein Nova-1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | miR-339-5p regulates the p53 tumor-suppressor pathway by targeting MDM2. Oncogene. 2015 Apr 9;34(15):1908-18. | ||||
| REF 2 | MicroRNA-339-5p down-regulates protein expression of -site amyloid precursor protein-cleaving enzyme 1 (BACE1) in human primary brain cultures and is reduced in brain tissue specimens of Alzheimer disease subjects. J Biol Chem. 2014 Feb 21;289(8):5184-98. | ||||
| REF 3 | MiR-339-5p regulates the growth, colony formation and metastasis of colorectal cancer cells by targeting PRL-1. PLoS One. 2013 May 16;8(5):e63142. | ||||
| REF 4 | MiR-339-5p inhibits breast cancer cell migration and invasion in vitro and may be a potential biomarker for breast cancer prognosis.BMC Cancer. 2010 Oct 9;10:542. | ||||
| REF 5 | MicroRNA-339, an epigenetic modulating target is involved in human gastric carcinogenesis through targeting NOVA1.FEBS Lett. 2015 Oct 7;589(20 Pt B):3205-11. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.