miRNA General Information
miRNA Mature ID	hsa-miR-345-5p
miRNA Stemloop AC	MI0000825
miRNA Stemloop ID	hsa-mir-345
Sequence	gcugacuccuaguccagggcuc
TTD Target(s) Regulated by This miRNA	Multidrug resistance-associated protein 1 (ABCC1)	Successful Target	Target Info	[1]
	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[2]
	Melanoma differentiation-associated protein 6 (CDKN1A)	Literature-reported Target	Target Info	[3]
References
REF 1	Alterations of microRNAs and their targets are associated with acquired resistance of MCF-7 breast cancer cells to cisplatin. Int J Cancer. 2010 Oct 15;127(8):1785-94.
REF 2	Allele variants in functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as susceptibility factors for anxiety disorders. Hum Mutat. 2009 Jul;30(7):1062-71.
REF 3	Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.