miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-363-3p | ||||
| miRNA Stemloop AC | MI0000764 | ||||
| miRNA Stemloop ID | hsa-mir-363 | ||||
| Sequence | aauugcacgguauccaucugua | ||||
| TTD Target(s) Regulated by This miRNA | Sphingosine-1-phosphate receptor 1 (S1PR1) | Successful Target | Target Info | [1] | |
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [2] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [3] | ||
| Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [4] | ||
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [5] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [6] | ||
| Regenerating islet-derived protein IV (REG4) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [2] | ||
| Disintegrin and metalloproteinase domain-containing protein 15 | Regulated Protein | [9] | |||
| Neuromodulin | Regulated Protein | [10] | |||
| Podoplanin | Regulated Protein | [11] | |||
| Transcription factor SOX-4 | Regulated Protein | [12] | |||
| Ubiquitin carboxyl-terminal hydrolase 28 | Regulated Protein | [13] | |||
| Unconventional myosin-Ib | Regulated Protein | [9] | |||
| Zinc finger protein 40 | Regulated Protein | [14] | |||
| References | |||||
| REF 1 | MicroRNA-363-mediated downregulation of S1PR1 suppresses the proliferation of hepatocellular carcinoma cells. Cell Signal. 2014 Jun;26(6):1347-54. | ||||
| REF 2 | Novel anti-apoptotic microRNAs 582-5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS One. 2014 May 7;9(5):e96239. | ||||
| REF 3 | Tumor Suppressor Role of miR-363-3p in Gastric Cancer. Med Sci Monit. 2015 Dec 28;21:4074-80. | ||||
| REF 4 | Oncogenic cAMP responsive element binding protein 1 is overexpressed upon loss of tumor suppressive miR-10b-5p and miR-363-3p in renal cancer. Oncol Rep. 2016 Apr;35(4):1967-78. | ||||
| REF 5 | miR-363 promotes proliferation and chemo-resistance of human gastric cancer via targeting of FBW7 ubiquitin ligase expression. Oncotarget. 2016 Jun 7;7(23):35284-92. | ||||
| REF 6 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 7 | MicroRNA target site identification by integrating sequence and binding information. Nat Methods. 2013 Jul;10(7):630-3. | ||||
| REF 8 | Novel anti-apoptotic microRNAs 582-5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS One. 2014 May 7;9(5):e96239. | ||||
| REF 9 | miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis. Surgery. 2013 Aug;154(2):226-33. | ||||
| REF 10 | MiRNA expression profiling in human gliomas: upregulated miR-363 increases cell survival and proliferation. Tumour Biol. 2016 Oct;37(10):14035-14048. | ||||
| REF 11 | Dysregulated miR-363 affects head and neck cancer invasion and metastasis by targeting podoplanin.Int J Biochem Cell Biol. 2013 Mar;45(3):513-20. | ||||
| REF 12 | MiR-363-3p inhibits the epithelial-to-mesenchymal transition and suppresses metastasis in colorectal cancer by targeting Sox4.Biochem Biophys Res Commun. 2016 May 20;474(1):35-42. | ||||
| REF 13 | A c-Myc-MicroRNA functional feedback loop affects hepatocarcinogenesis. Hepatology. 2013 Jun;57(6):2378-89. | ||||
| REF 14 | Downregulation of tumor suppressor MBP-1 by microRNA-363 in gastric carcinogenesis.Carcinogenesis. 2014 Jan;35(1):208-17. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.