miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-367-3p | ||||
| miRNA Stemloop AC | MI0000775 | ||||
| miRNA Stemloop ID | hsa-mir-367 | ||||
| Sequence | aauugcacuuuagcaaugguga | ||||
| TTD Target(s) Regulated by This miRNA | Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [1] | |
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [2] | ||
| F-box and WD-40 domain protein 7 (Fbxw7) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Ras-related protein Rab-23 | Regulated Protein | [4] | ||
| References | |||||
| REF 1 | The miR-367-3p Increases Sorafenib Chemotherapy Efficacy to Suppress Hepatocellular Carcinoma Metastasis through Altering the Androgen Receptor Signals. EBioMedicine. 2016 Oct;12:55-67. | ||||
| REF 2 | MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58. | ||||
| REF 3 | miR-367 promotes the proliferation and invasion of non-small cell lung cancer via targeting FBXW7. Oncol Rep. 2017 Feb;37(2):1052-1058. | ||||
| REF 4 | The microRNA-367 inhibits the invasion and metastasis of gastric cancer by directly repressing Rab23.Genet Test Mol Biomarkers. 2015 Feb;19(2):69-74. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.