miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-372-3p | ||||
| miRNA Stemloop AC | MI0000780 | ||||
| miRNA Stemloop ID | hsa-mir-372 | ||||
| Sequence | aaagugcugcgacauuugagcgu | ||||
| TTD Target(s) Regulated by This miRNA | Erbb4 tyrosine kinase receptor (Erbb-4) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [3] | ||
| Wee1-like protein kinase (WEE1) | Clinical trial Target | Target Info | [4] | ||
| Dickkopf-related protein 1 (DKK1) | Clinical trial Target | Target Info | [5] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [5] | ||
| Large tumor suppressor homolog 2 (LATS2) | Literature-reported Target | Target Info | [6] | ||
| ATPase family AAA domain containing 2 (ATAD2) | Literature-reported Target | Target Info | [7] | ||
| Orphan nuclear receptor NURR1 (NR4A2) | Literature-reported Target | Target Info | [1] | ||
| Vitamin D3 up-regulated protein 1 (VDUP1) | Literature-reported Target | Target Info | [8] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [9] | ||
| Muscleblind-like protein 1 (MBNL2) | Literature-reported Target | Target Info | [10] | ||
| B-cell translocation gene 1 protein (BTG1) | Literature-reported Target | Target Info | [5] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [11] | ||
| Protein(s) Regulated by This miRNA | BTB/POZ domain-containing adapter for CUL3-mediated RhoA degradation protein 2 | Regulated Protein | [12] | ||
| Cyclin-A1 | Regulated Protein | [13] | |||
| Krueppel-like factor 13 | Regulated Protein | [10] | |||
| Left-right determination factor 1 | Regulated Protein | [5] | |||
| Nuclear factor 1 B-type | Regulated Protein | [16] | |||
| PH domain leucine-rich repeat-containing protein phosphatase 2 | Regulated Protein | [17] | |||
| Rho-related GTP-binding protein RhoC | Regulated Protein | [18] | |||
| Zinc finger transcription factor Trps1 | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102. | ||||
| REF 2 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 3 | CUL4B promotes replication licensing by up-regulating the CDK2-CDC6 cascade. J Cell Biol. 2013 Mar 18;200(6):743-56. | ||||
| REF 4 | microRNAs regulate human embryonic stem cell division. Cell Cycle. 2009 Nov 15;8(22):3729-41. | ||||
| REF 5 | -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78. | ||||
| REF 6 | A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell. 2006 Mar 24;124(6):1169-81. | ||||
| REF 7 | miR-372 down-regulates the oncogene ATAD2 to influence hepatocellular carcinoma proliferation and metastasis. BMC Cancer. 2014 Feb 19;14:107. | ||||
| REF 8 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 9 | MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 2008 Apr;28(7):2167-74. | ||||
| REF 10 | Target identification of microRNAs expressed highly in human embryonic stem cells. J Cell Biochem. 2009 Apr 15;106(6):1020-30. | ||||
| REF 11 | MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80. | ||||
| REF 12 | microRNA-372 maintains oncogene characteristics by targeting TNFAIP1 and affects NFB signaling in human gastric carcinoma cells.Int J Oncol. 2013 Feb;42(2):635-42. | ||||
| REF 13 | MicroRNA-372 is down-regulated and targets cyclin-dependent kinase 2 (CDK2) and cyclin A1 in human cervical cancer, which may contribute to tumorigenesis. J Biol Chem. 2011 Jul 22;286(29):25556-63. | ||||
| REF 14 | Target identification of microRNAs expressed highly in human embryonic stem cells. J Cell Biochem. 2009 Apr 15;106(6):1020-30. | ||||
| REF 15 | -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78. | ||||
| REF 16 | MicroRNAs-372/373 promote the expression of hepatitis B virus through the targeting of nuclear factor I/B.Hepatology. 2011 Sep 2;54(3):808-19. | ||||
| REF 17 | miR-372 regulates glioma cell proliferation and invasion by directly targeting PHLPP2.J Cell Biochem. 2015 Feb;116(2):225-32. | ||||
| REF 18 | Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol. 2011 May;29(5):443-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.