miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-377-3p | ||||
| miRNA Stemloop AC | MI0000785 | ||||
| miRNA Stemloop ID | hsa-mir-377 | ||||
| Sequence | aucacacaaaggcaacuuuugu | ||||
| TTD Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | |
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [2] | ||
| Superoxide dismutase Cu-Zn (SOD Cu-Zn) | Clinical trial Target | Target Info | [3] | ||
| Superoxide dismutase Mn (SOD Mn) | Clinical trial Target | Target Info | [3] | ||
| Hematopoietic progenitor cell antigen CD34 (CD34) | Clinical trial Target | Target Info | [4] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [5] | ||
| PAK-1 protein kinase (PAK1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Metalloproteinase inhibitor 1 | Regulated Protein | [1] | ||
| Protein phosphatase 1A | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MicroRNA-377 predicts poor clinical outcome of gastric cancer and induces tumorigenesis by targeting multiple tumor-suppressor genes. Oncol Rep. 2015 Jul;34(1):203-10. | ||||
| REF 2 | miR-377 induces senescence in human skin fibroblasts by targeting DNA methyltransferase 1. Cell Death Dis. 2017 Mar 9;8(3):e2663. | ||||
| REF 3 | MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35. | ||||
| REF 4 | Identification of apoptosis-related microRNAs and their target genes in myocardial infarction post-transplantation with skeletal myoblasts. J Transl Med. 2015 Aug 19;13:270. | ||||
| REF 5 | Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32. | ||||
| REF 6 | MicroRNA-377 predicts poor clinical outcome of gastric cancer and induces tumorigenesis by targeting multiple tumor-suppressor genes. Oncol Rep. 2015 Jul;34(1):203-10. | ||||
| REF 7 | MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.