miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-382-5p | ||||
| miRNA Stemloop AC | MI0000790 | ||||
| miRNA Stemloop ID | hsa-mir-382 | ||||
| Sequence | gaaguuguucgugguggauucg | ||||
| TTD Target(s) Regulated by This miRNA | Dopamine D1 receptor (D1R) | Successful Target | Target Info | [1] | |
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Max dimerization protein 1 | Regulated Protein | [3] | ||
| Nuclear factor 1 A-type | Regulated Protein | [4] | |||
| Nuclease-sensitive element-binding protein 1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | MicroRNA expression profile and functional analysis reveal that miR-382 is a critical novel gene of alcohol addiction. EMBO Mol Med. 2013 Sep;5(9):1402-14. | ||||
| REF 2 | MicroRNA-382 induced by HIF-1 is an angiogenic miR targeting the tumor suppressor phosphatase and tensin homolog. Nucleic Acids Res. 2014 Jul;42(12):8062-72. | ||||
| REF 3 | miR-382-5p Controls Hematopoietic Stem Cell Differentiation Through the Downregulation of MXD1.Stem Cells Dev. 2016 Oct 1;25(19):1433-43. | ||||
| REF 4 | RP5-833A20.1/miR-382-5p/NFIA-dependent signal transduction pathway contributes to the regulation of cholesterol homeostasis and inflammatory reaction.Arterioscler Thromb Vasc Biol. 2015 Jan;35(1):87-101. | ||||
| REF 5 | miR-382 inhibits osteosarcoma metastasis and relapse by targeting Y box-binding protein 1.Mol Ther. 2015 Jan;23(1):89-98. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.