miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-383-5p | ||||
| miRNA Stemloop AC | MI0000791 | ||||
| miRNA Stemloop ID | hsa-mir-383 | ||||
| Sequence | agaucagaaggugauuguggcu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
| Iodothyronine deiodinase type I (DIO1) | Successful Target | Target Info | [3] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [4] | ||
| Serine/threonine-protein kinase ATR (FRP1) | Clinical trial Target | Target Info | [5] | ||
| A proliferation-inducing ligand (APRIL) | Clinical trial Target | Target Info | [6] | ||
| Interferon regulatory factor 1 (IRF1) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Serine/threonine-protein phosphatase 1 regulatory subunit 10 | Regulated Protein | [8] | ||
| Thioredoxin-dependent peroxide reductase, mitochondrial | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | Downregulation of miR-383 promotes glioma cell invasion by targeting insulin-like growth factor 1 receptor. Med Oncol. 2013;30(2):557. | ||||
| REF 2 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 3 | MiR-224 targets the 3'UTR of type 1 5'-iodothyronine deiodinase possibly contributing to tissue hypothyroidism in renal cancer. PLoS One. 2011;6(9):e24541. | ||||
| REF 4 | The targeting and functions of miRNA-383 are mediated by FMRP during spermatogenesis. Cell Death Dis. 2013 May 2;4:e617. | ||||
| REF 5 | STAT3 regulated ATR via microRNA-383 to control DNA damage to affect apoptosis in A431 cells. Cell Signal. 2015 Nov;27(11):2285-95. | ||||
| REF 6 | miR-383 inhibits hepatocellular carcinoma cell proliferation via targeting APRIL. Tumour Biol. 2016 Feb;37(2):2497-507. | ||||
| REF 7 | Downregulation of microRNA-383 is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation by targeting IRF1. Cell Death Dis. 2010 Nov 4;1:e94. | ||||
| REF 8 | microRNA-383 impairs phosphorylation of H2AX by targeting PNUTS and inducing cell cycle arrest in testicular embryonal carcinoma cells.Cell Signal. 2014 May;26(5):903-11. | ||||
| REF 9 | MiR-383 is downregulated in medulloblastoma and targets peroxiredoxin 3 (PRDX3).Brain Pathol. 2013 Jul;23(4):413-25. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.