miRNA General Information
miRNA Mature ID	hsa-miR-384
miRNA Stemloop AC	MI0001145
miRNA Stemloop ID	hsa-mir-384
Sequence	auuccuagaaauuguucaua
TTD Target(s) Regulated by This miRNA	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[1]
	Endoplasmic reticulum chaperone BiP (HSPA5)	Clinical trial Target	Target Info	[2]
	F-box and WD-40 domain protein 7 (Fbxw7)	Literature-reported Target	Target Info	[3]
	Insulin receptor substrate-1 (IRS1)	Clinical trial Target	Target Info	[4]
References
REF 1	Allele variants in functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as susceptibility factors for anxiety disorders. Hum Mutat. 2009 Jul;30(7):1062-71.
REF 2	Downregulation of miR-384-5p attenuates rotenone-induced neurotoxicity in dopaminergic SH-SY5Y cells through inhibiting endoplasmic reticulum stress. Am J Physiol Cell Physiol. 2016 May 1;310(9):C755-63.
REF 3	MiR-384 inhibits human colorectal cancer metastasis by targeting KRAS and CDC42. Oncotarget. 2016 Dec 20;7(51):84826-84838.
REF 4	MiR-384 regulated IRS1 expression and suppressed cell proliferation of human hepatocellular carcinoma. Tumour Biol. 2016 Oct;37(10):14165-14171.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.