miRNA General Information
miRNA Mature ID hsa-miR-450a-1-3p
miRNA Stemloop AC MI0001652
miRNA Stemloop ID hsa-mir-450a-1
Sequence auugggaacauuuugcauguau
TTD Target(s) Regulated by This miRNA BUB1 mitotic checkpoint serine/threonine kinase (BUB1) Patented-recorded Target Target Info [1]
References
REF 1 MicroRNA-450a-3p represses cell proliferation and regulates embryo development by regulating Bub1 expression in mouse. PLoS One. 2012;7(10):e47914.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.