miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-450a-1-3p | ||||
miRNA Stemloop AC | MI0001652 | ||||
miRNA Stemloop ID | hsa-mir-450a-1 | ||||
Sequence | auugggaacauuuugcauguau | ||||
TTD Target(s) Regulated by This miRNA | BUB1 mitotic checkpoint serine/threonine kinase (BUB1) | Patented-recorded Target | Target Info | [1] | |
References | |||||
REF 1 | MicroRNA-450a-3p represses cell proliferation and regulates embryo development by regulating Bub1 expression in mouse. PLoS One. 2012;7(10):e47914. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.